Previous Contig 004797:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006F07Sequence352004797 (4)gb:AY448010S7_16066034e-45Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR7.438013176 (5)pir|T47441|T474412e-37hypothetical protein T18B22.60 - Arabidopsis thaliana>gb:ATT18B22_1554761 Arabid
JMSF019C22Sequence237004797 (4)gb:AY448010S7_16066033e-21Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR7.702013176 (5)gb:BT002003_16356063e-65Arabidopsis thaliana putative protein (At3g44680) mRNA, complete cds.>gb:BT00657
JMSF038K08Sequence664004797 (4)gb:AY448010S7_1606603e-118Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR7.804013176 (5)gb:BT002003_16356061e-84Arabidopsis thaliana putative protein (At3g44680) mRNA, complete cds.>gb:BT00657
JMSF044I15Sequence794004797 (4)gb:AY448010S7_1606603e-111Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR7.754013176 (5)gb:BT002003_16356061e-84Arabidopsis thaliana putative protein (At3g44680) mRNA, complete cds.>gb:BT00657

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044I15+ TTTGCTAGCTACAAAGTGAACTTGATTGAGCANTAAATGGGTTTAAA
                      ____________________________________________________________
consensus TTTGCTAGCTACAAAGTGAACTTGATTGAGCANTAAATGGGTTTAAA
 
. : . : . : . : . : . :
JMSF044I15+ ATCTATGGCCCTGTTTGAATTTGACATTGAACAACAGTTATGGATTATGTAACACTACAA
                      ____________________________________________________________
consensus ATCTATGGCCCTGTTTGAATTTGACATTGAACAACAGTTATGGATTATGTAACACTACAA
 
. : . : . : . : . : . :
JMSF038K08+ CCTATCTGT
JMSF044I15+ ATACATACCGGTCTAAGAAAAACTAAGAGATAAGTGAAGAGAGTAAAGGTACCTATCTGT
                      ____________________________________________________________
consensus ATACATACCGGTCTAAGAAAAACTAAGAGATAAGTGAAGAGAGTAAAGGTACCTATCTGT
 
. : . : . : . : . : . :
JMSF038K08+ AAAATAAAAGGCCTCTTCCACACCATCTCCATGATGTACATCAATATCAATATACAAAAC
JMSF044I15+ AAAATAAAAGGCCTCTTCCACACCATCTCCATGATGTACATCAATATCAATATACAAAAC
                      ____________________________________________________________
consensus AAAATAAAAGGCCTCTTCCACACCATCTCCATGATGTACATCAATATCAATATACAAAAC
 
. : . : . : . : . : . :
JMSF038K08+ TCGGGGATGATATTTGAGAAGCTCCAAAATTCCCAGAACTAGATCATTGATATAACAAAA
JMSF044I15+ TCGGGGATGATATTTGAGAAGCTCCAAAATTCCCAGAACTAGATCATTGATATAACAAAA
                      ____________________________________________________________
consensus TCGGGGATGATATTTGAGAAGCTCCAAAATTCCCAGAACTAGATCATTGATATAACAAAA
 
. : . : . : . : . : . :
JMSF038K08+ TCCTGAAGCCTCACACTTTTTGGCGTGGTGCAAACCACCAGCCCAATTTATGGCGACATC
JMSF044I15+ TCCTGAAGCCTCACACTTTTTGGCGTGGTGCAAACCACCAGCCCAATTTATGGCGACATC
                      ____________________________________________________________
consensus TCCTGAAGCCTCACACTTTTTGGCGTGGTGCAAACCACCAGCCCAATTTATGGCGACATC
 
. : . : . : . : . : . :
JMSF038K08+ ACAGAGTTGATTGTTTAATCTACGCGCAGCATCTATTGTTCCTCCAGCATAAATTTGACA
JMSF044I15+ ACAGAGTTGATTGTTTAATCTACGCGCAGCATCTATTGTTCCACCAGCATAAATTTGACA
                      ____________________________________________________________
consensus ACAGAGTTGATTGTTTAATCTACGCGCAGCATCTATTGTTCCTCCAGCATAAATTTGACA
 
. : . : . : . : . : . :
JMSF038K08+ AAACTCAAACAGGTTATCAAATACAGGGCAATCTTCTCCAAGATTATATCTTTTGAGGTC
JMSF044I15+ AAACTCAAACAGGTTATCAAATACAGGGCAATCTTCTCCAAGATTATATCTTTTGAGGTC
                      ____________________________________________________________
consensus AAACTCAAACAGGTTATCAAATACAGGGCAATCTTCTCCAAGATTATATCTTTTGAGGTC
 
. : . : . : . : . : . :
JMSF038K08+ AATCCCAAATAAATGTTGAGTGTCAGGCGTTATCCGGTGCAGAAACTCAACGTAATCAGC
JMSF044I15+ AATCCCAAATAAATGTTGAGTGTCAGGCGTTATCCGGTGCAGAAACTCAACGTAATCAGC
JMSF006F07+ ATAAATGTTGAGTGTCAGGCGTTATCCGGTGCAGAAACTCAACGTAATCAGC
                      ____________________________________________________________
consensus AATCCCAAATAAATGTTGAGTGTCAGGCGTTATCCGGTGCAGAAACTCAACGTAATCAGC
 
. : . : . : . : . : . :
JMSF038K08+ TGAATGGAACTGCGCCAGCTCCATNGGATATGCCTTATGAGGCCTATAAATTTCCATCTT
JMSF044I15+ TGAATGGAACTGCGCCAGCTCCATTGGATATGCCTTATGAGGCCTATAAATTTCCATCTT
JMSF006F07+ TGAATGGAACTGCGCCAGCTCCATTGGATATGCCTTATGAGGCCTATAAATTTCCATCTT
                      ____________________________________________________________
consensus TGAATGGAACTGCGCCAGCTCCATTGGATATGCCTTATGAGGCCTATAAATTTCCATCTT
 
. : . : . : . : . : . :
JMSF038K08+ GTTGTGGAGACCGTAAGCTAGAACCAGATGATGAGTCATACACAGCCGGTGCGGTTTCAT
JMSF044I15+ GTTGTGGAGACCGTAAGCTAGAACCAGATGATGAGTCATACACAGCCGGTGCGGTTTCAT
JMSF019C22+ GTGGAGACCGTAAGCTAGAACCAGATGATGAGTCATACACAGCCGGTGCGGTTTCAT
JMSF006F07+ GTTGTGGAGACCGTAAGCTAGAACCAGATGATGAGTCATACACAGCCGGTGCGGTTTCAT
                      ____________________________________________________________
consensus GTTGTGGAGACCGTAAGCTAGAACCAGATGATGAGTCATACACAGCCGGTGCGGTTTCAT
 
. : . : . : . : . : . :
JMSF038K08+ CGGATGGTTTGGCCCAAAGTAGACATTCCCAACGTCCCCATCGTAGAAGTAGGAGATTCT
JMSF044I15+ CGGATGGTTTGGCCCAAAGTAGACATTCCCAACGTCCCCATCGTAGAAGTAGGAGATTCT
JMSF019C22+ CGGATGGTTTGGCCCAAAGTAGACATTCCCAACGTCCCCATCGTAGAAGTAGGAGATTCT
JMSF006F07+ CGGATGGTTTGGCCCAAAGTAGACATTCCCAACGTCCCCATCGTAGAAGTAGGAGATTCT
                      ____________________________________________________________
consensus CGGATGGTTTGGCCCAAAGTAGACATTCCCAACGTCCCCATCGTAGAAGTAGGAGATTCT
 
. : . : . : . : . : . :
JMSF038K08+ GTCCTTGGAGCGCATTTTAGCGAAGAGCCTAAATGGAGGGAAAATCAGTGGGAGGGAGAG
JMSF044I15+ GTCCTTGGAGCGCATTTTAGCGAAGAGCCTAAATGGAGGGAAAATCAGTGGGAGGGAGAG
JMSF019C22+ GTCCTTGGAGCGCATTTTAGCGAAGAGCCTAAATGGAGGGAAAATCAGTGGGAGGGAGAG
JMSF006F07+ GTCCTTGGAGCGCATTTTAGCGAAGAGCCTAAATGGAGGGAAAATCAGTGGGAGGGAGAG
                      ____________________________________________________________
consensus GTCCTTGGAGCGCATTTTAGCGAAGAGCCTAAATGGAGGGAAAATCAGTGGGAGGGAGAG
 
. : . : . : . : . : . :
JMSF038K08+ AGAGAGAGAGGGCGTACTGACTC
JMSF044I15+ AGAGAGAGAGGGCGTACTGACTC
JMSF019C22+ AGAGAGAGAGGGCGTACTGACTCAACGAGTTTTAGCCATGTATGAAATTCTGAATTCCCC
JMSF006F07+ AGAGAGAGAGGGCGTACTGACTCAACGAGTTTTAGCCATGTATGAAATTCTGAATTCCCC
                      ____________________________________________________________
consensus AGAGAGAGAGGGCGTACTGACTCAACGAGTTTTAGCCATGTATGAAATTCTGAATTCCCC