Previous Contig 004795:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008P14Sequence538004795 (10)gb:AY099550_15765766e-32Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.747010374 (10)gb:AY133619_15814422e-75Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392
JMFF010B23Sequence547004795 (10)gb:AY099550_15765763e-33Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.746010374 (10)gb:AY133619_15814425e-76Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392
JMFF010H09Sequence585004795 (10)gb:AY099550_15765761e-38Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.750010374 (10)gb:AY133619_15814422e-75Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392
JMFF011N05Sequence547004795 (10)gb:AY099550_15765766e-29Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.749010374 (10)gb:AY133619_15814422e-76Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392
JMFF043P03Sequence637004795 (10)gb:AY099550_15765762e-42Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.605010374 (10)gb:AK175716_18177043e-54Arabidopsis thaliana mRNA, partial cds, clone: RAFL22-25-K02.>gb:AK175979_181796
JMFF048G07Sequence399004795 (10)gb:AY099550_15765769e-15Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.352010374 (10)gb:AP005511_18531291e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF006E24Sequence380004795 (10)gb:AY099550_15765761e-14Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.
JMSF034L20Sequence702004795 (10)gb:AY099550_15765765e-50Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.731010374 (10)gb:AY133619_15814425e-76Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392
JMSF036M17Sequence679004795 (10)gb:AY099550_15765763e-51Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.709010374 (10)gb:AY133619_15814422e-74Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392
JMSF038K18Sequence647004795 (10)gb:AY099550_15765761e-46Arabidopsis thaliana unknown protein (At1g53210) mRNA, complete cds.899010374 (10)gb:AY133619_15814422e-87Arabidopsis thaliana At1g53210/F12M16_12 mRNA, complete cds.>gb:AF361800_1791392

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036M17+ CACAGAGACAGCCATGATTA
JMSF034L20+ AACTGCACAACCACAAATNGGACCACAGAGACAGCCATGATTA
                      ____________________________________________________________
consensus AACTGCACAACCACAAATNGGACCACAGAGACAGCCATGATTA
 
. : . : . : . : . : . :
JMSF036M17+ TTGCGGCATAGCTAGTCCATACATCAGTAGTAACACCAGAGCCAGTCAAACTGAATGCTT
JMSF038K18+ TAGTCCATACATCAGTAGTAACACCAGAGCCAGTCAAACTGAATGCTT
JMFF043P03+ CATCAGTAGTAACACCAGAGCCAGTCAAACTGAATGCTN
JMSF034L20+ TTGCGGCATAGCTAGTCCATACATCAGTAGTAACACCAGAGCCAGTCAAACTGAATGCTT
                      ____________________________________________________________
consensus TTGCGGCATAGCTAGTCCATACATCAGTAGTAACACCAGAGCCAGTCAAACTGAATGCTT
 
. : . : . : . : . : . :
JMSF036M17+ TAGTGTCTTTCAAGTCTACAGCAACAGCGTTTTGTATGTCACACTTCCCAACAACAACAC
JMSF038K18+ TAGTGTCTTTCAAGTCTACAGCAACAGCGTTTTGTATGTCACACTTCCCAACAACAACAC
JMFF043P03+ TAGTGTCTTTCAAGTCTACAGCAACAGCGTNTTGTATGTCACACTTCCCAACAACAACAT
JMFF011N05+ AACAACAC
JMFF010H09+ GTCTACAGCAACAGCGTTTTGTATGTCACACTTCCCANCAACAACAC
JMFF010B23+ CAACAACAC
JMSF034L20+ TAGTGTCTTTCAAGTCTACAGCAACAGCGTTTTGTATGTCACACTTCCCAACAACAACAC
                      ____________________________________________________________
consensus TAGTGTCTTTCAAGTCTACAGCAACAGCGTTTTGTATGTCACACTTCCCAACAACAACAC
 
. : . : . : . : . : . :
JMSF036M17+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
JMSF038K18+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
JMFF043P03+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
JMFF011N05+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
JMFF010H09+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
JMFF010B23+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
JMFF008P14+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGNTAGCAGGCCCATTCCAA
JMSF034L20+ AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
                      ____________________________________________________________
consensus AGGTTCCCCATATCACAGTGAGAAGCATAACAGTTGACCCAGCTAGCAGGCCCATTCCAA
 
. : . : . : . : . : . :
JMSF036M17+ CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
JMSF038K18+ CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
JMFF043P03+ CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
JMFF011N05+ CAGATACCTGGCTCTGAGCTTCAGCAACACTTNCCTGATAATCCAGATACGAGAATGAGC
JMFF010H09+ CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
JMFF010B23+ CAGATACCTGGCTNTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
JMFF008P14+ CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
JMSF034L20+ CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
                      ____________________________________________________________
consensus CAGATACCTGGCTCTGAGCTTCAGCAACACTT-CCTGATAATCCAGATACGAGAATGAGC
 
. : . : . : . : . : . :
JMSF036M17+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMSF038K18+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMFF043P03+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMFF011N05+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMFF010H09+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMFF010B23+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMFF048G07+ CGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMFF008P14+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMSF034L20+ ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
JMSF006E24+ CGCCGATGAGACCAGGACCG
                      ____________________________________________________________
consensus ATAGCATCCGGAAGAGCACCGAGGATAGGGAGGAAGAGACCGCCGATGAGACCAGGACCG
 
. : . : . : . : . : . :
JMSF036M17+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMSF038K18+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMFF043P03+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMFF011N05+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMFF010H09+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMFF010B23+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMFF048G07+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMFF008P14+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMSF034L20+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
JMSF006E24+ AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
                      ____________________________________________________________
consensus AGAATCTCAAGCAACAGTTCACTGCCGGAGGAGAGGTAGGTAGCAGCAAGGAACATGAGG
 
. : . : . : . : . : . :
JMSF036M17+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMSF038K18+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMFF043P03+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMFF011N05+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMFF010H09+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMFF010B23+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMFF048G07+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMFF008P14+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMSF034L20+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
JMSF006E24+ TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
                      ____________________________________________________________
consensus TATCCATAGACTAAAATCAGGAAGAGATTACCGAGAGCAGTGGTAGTACAAGGCAAAAAG
 
. : . : . : . : . : . :
JMSF036M17+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMSF038K18+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMFF043P03+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMFF011N05+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMFF010H09+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMFF010B23+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMFF048G07+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMFF008P14+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMSF034L20+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
JMSF006E24+ CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
                      ____________________________________________________________
consensus CCGTAGCTCTGCTCGCAGGTCTCCTCCTCCGGCGCCAAAACGCCGAGACGGAGGACCCCC
 
. : . : . : . : . : . :
JMSF036M17+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMSF038K18+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMFF043P03+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMFF011N05+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMFF010H09+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMFF010B23+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMFF048G07+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCCACG
JMFF008P14+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMSF034L20+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
JMSF006E24+ GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
                      ____________________________________________________________
consensus GATCCTTCGCCGGCGCTGTGTACGCCGCCGTCGGATACGAGATCCGAGGAACGGTCGACG
 
. : . : . : . : . : . :
JMSF036M17+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMSF038K18+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMFF043P03+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMFF011N05+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMFF010H09+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMFF010B23+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMFF048G07+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMFF008P14+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMSF034L20+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
JMSF006E24+ ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
                      ____________________________________________________________
consensus ATTAAGCGGGCGTACGCGGCGCATGAGAGGATCAGGATAAGGAGAAGGAGAAGCGGAAGA
 
. : . : . : . : . : . :
JMSF036M17+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMSF038K18+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACA
JMFF043P03+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMFF011N05+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMFF010H09+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMFF010B23+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMFF048G07+ GTCGCCTTTAACGCCATTTTGGCCGCCATGA-TTGCAGAGAATTGGATAAACTGCACAC
JMFF008P14+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMSF034L20+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACAC
JMSF006E24+ GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACACC
                      ____________________________________________________________
consensus GTCGCCTTTAACGCCATTTTGGCCGCCATGATTTGCAGAGAATTGGATAAACTGCACACC