Previous Contig 004792:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS104F08Sequence609004792 (2)gb:AY800655_16286032e-33Arabidopsis thaliana clone H0000001203 hypothetical protein (AT5G66600) mRNA, co
JMSF006E17Sequence466004792 (2)364010323 (6)gb:CAR275312_16451974e-13Cicer arietinum partial mRNA for RAS-like protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS104F08+ AAAGTCCAGCCTTCTTCTTGGCGTGCCTACTAGAGATTTT
                      ____________________________________________________________
consensus AAAGTCCAGCCTTCTTCTTGGCGTGCCTACTAGAGATTTT
 
. : . : . : . : . : . :
JMFS104F08+ AGTTTGTCGTCAATTCTGGAAGGTGATGAGGTTGAGATTTGCTGATCAAACGCTTTTCGG
                      ____________________________________________________________
consensus AGTTTGTCGTCAATTCTGGAAGGTGATGAGGTTGAGATTTGCTGATCAAACGCTTTTCGG
 
. : . : . : . : . : . :
JMFS104F08+ TATAGTGAAAGGAGGTACTGTTCCAAATGCCCAACTTCGAACTCTAGTACAGCTATTTCT
                      ____________________________________________________________
consensus TATAGTGAAAGGAGGTACTGTTCCAAATGCCCAACTTCGAACTCTAGTACAGCTATTTCT
 
. : . : . : . : . : . :
JMFS104F08+ CGAATCAGTTCTGTGGCCGGCTTAGGTATCGAGATTTCATCTGCGGTCTTCTGGCATGTA
                      ____________________________________________________________
consensus CGAATCAGTTCTGTGGCCGGCTTAGGTATCGAGATTTCATCTGCGGTCTTCTGGCATGTA
 
. : . : . : . : . : . :
JMFS104F08+ GACCGATACCCTAACGCTTTCTCTAGAGCACATCGGACAGCAACTTGGGTCTGCAATCGT
                      ____________________________________________________________
consensus GACCGATACCCTAACGCTTTCTCTAGAGCACATCGGACAGCAACTTGGGTCTGCAATCGT
 
. : . : . : . : . : . :
JMFS104F08+ TTCTCGAGTTGCATTATCTCTTGCGTTAATGAACTTTGGACCTCGGCAGTAGATGATTGT
                      ____________________________________________________________
consensus TTCTCGAGTTGCATTATCTCTTGCGTTAATGAACTTTGGACCTCGGCAGTAGATGATTGT
 
. : . : . : . : . : . :
JMFS104F08+ TTCTTCTTGCTCTCGAAGCAATCATCTGAGTGCTCCATATCCAACTTCAATTCAGGGGAA
JMSF006E17+ GAAGCAATCATNTGAGTGCTCCATATCCAACTTCAATTCAGGGGAA
                      ____________________________________________________________
consensus TTCTTCTTGCTCTCGAAGCAATCATCTGAGTGCTCCATATCCAACTTCAATTCAGGGGAA
 
. : . : . : . : . : . :
JMFS104F08+ GCCTCGGGGGAACAACGAAAACTATCATGTCCAGTTTTTACGCTATCTGGAAAGCTCTTA
JMSF006E17+ GCCTCGGGGGAACAACGAAAACTATCATGTCCAGTTTTTACGCTATCTGGAAAGCTCTTA
                      ____________________________________________________________
consensus GCCTCGGGGGAACAACGAAAACTATCATGTCCAGTTTTTACGCTATCTGGAAAGCTCTTA
 
. : . : . : . : . : . :
JMFS104F08+ GAACGCTTGTGTGTACAGGTTCTCATAGCCGCCCCAGGGGATTCATCGAAGCTAAACCCT
JMSF006E17+ GAACGCTTGTGTGTACAGGTTCTCATAGCCGCCCCAGGGGATTCATCGAAGCTAAACCCT
                      ____________________________________________________________
consensus GAACGCTTGTGTGTACAGGTTCTCATAGCCGCCCCAGGGGATTCATCGAAGCTAAACCCT
 
. : . : . : . : . : . :
JMFS104F08+ TCAAACCCCATCACT
JMSF006E17+ TCAAACCCCATCACTCAACATTACAAGCCTATAAGCAAAGAAATCAGCTACCAAGATTGG
                      ____________________________________________________________
consensus TCAAACCCCATCACTCAACATTACAAGCCTATAAGCAAAGAAATCAGCTACCAAGATTGG
 
. : . : . : . : . : . :
JMSF006E17+ ATTTTTCCGACCGACCCAGAAGTCCCAGATGCTCAAAAACATCCAACGGGTCCTCGAAAA
                      ____________________________________________________________
consensus ATTTTTCCGACCGACCCAGAAGTCCCAGATGCTCAAAAACATCCAACGGGTCCTCGAAAA
 
. : . : . : . : . : . :
JMSF006E17+ CCACAACTTGGAATCAAGACCCCACCTTTCTCCCTTGCATTGTTCGAAACACCCAAGTTA
                      ____________________________________________________________
consensus CCACAACTTGGAATCAAGACCCCACCTTTCTCCCTTGCATTGTTCGAAACACCCAAGTTA
 
. : . : . : . : . : . :
JMSF006E17+ ATTAGCGAACCCGGCAACGATTTCTTGCGTTTTTCACTGCCACACCCAAATTGACAAGGC
                      ____________________________________________________________
consensus ATTAGCGAACCCGGCAACGATTTCTTGCGTTTTTCACTGCCACACCCAAATTGACAAGGC
 
. : . : . : . : . : . :
JMSF006E17+ AATAAACTAGTACAAATAGTTCACAGTCCCAATAGAGTAATGCCAACCCATACCACCACC
                      ____________________________________________________________
consensus AATAAACTAGTACAAATAGTTCACAGTCCCAATAGAGTAATGCCAACCCATACCACCACC