Previous Contig 004788:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006E03Sequence385004788 (3)gb:AF165924_17739010.019Gossypium hirsutum auxin-induced basic helix-loop-helix transcription factor mRN
JMSF037C24Sequence705004788 (3)gb:AF165924_17739013e-45Gossypium hirsutum auxin-induced basic helix-loop-helix transcription factor mRN586013085 (2)gb:AMA580844_18191778e-13Antirrhinum majus subsp. majus mRNA for TCP-domain protein (tic gene).
JMSF048B18Sequence662004788 (3)gb:AF165924_17739014e-27Gossypium hirsutum auxin-induced basic helix-loop-helix transcription factor mRN773013085 (2)gb:AMA580844_18191772e-28Antirrhinum majus subsp. majus mRNA for TCP-domain protein (tic gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037C24+ GCGGCAGCCGAGAGCTGCATACTAGGG
                      ____________________________________________________________
consensus GCGGCAGCCGAGAGCTGCATACTAGGG
 
. : . : . : . : . : . :
JMSF037C24+ TTATTGATATTGATATTCGCCCCCTGGAAATTCAGCAGCGTGGTGGCGGAGCTGTCCGCC
                      ____________________________________________________________
consensus TTATTGATATTGATATTCGCCCCCTGGAAATTCAGCAGCGTGGTGGCGGAGCTGTCCGCC
 
. : . : . : . : . : . :
JMSF037C24+ GGCGACAACCCGATTCCGGCCGGGAAGAGGCTCCGCCGCTGCGAGAGCGAGAAGTTAGGG
                      ____________________________________________________________
consensus GGCGACAACCCGATTCCGGCCGGGAAGAGGCTCCGCCGCTGCGAGAGCGAGAAGTTAGGG
 
. : . : . : . : . : . :
JMSF037C24+ TTGAAATACTGAGATCGTAGCTGAGACGGCACGGACATGCTCGACCCGGAGCTCCGCAAG
                      ____________________________________________________________
consensus TTGAAATACTGAGATCGTAGCTGAGACGGCACGGACATGCTCGACCCGGAGCTCCGCAAG
 
. : . : . : . : . : . :
JMSF037C24+ GAAATATTAAGCGACGTGAAATTGGCGGGAATCGTGCCGGTCCCGGTGGCGGCTATCACA
                      ____________________________________________________________
consensus GAAATATTAAGCGACGTGAAATTGGCGGGAATCGTGCCGGTCCCGGTGGCGGCTATCACA
 
. : . : . : . : . : . :
JMSF037C24+ GCCGGCTCGGCCTGCTGGAGCAGCCACTCGATGGTCTCCCCGTCGGACTTGTGGCCGAGC
JMSF048B18+ GCCGGCTCGGCCTGCTGGAGCAGCCACTCGATGGTCTCCCCGTCGGACTTGTGGCCGAGC
                      ____________________________________________________________
consensus GCCGGCTCGGCCTGCTGGAGCAGCCACTCGATGGTCTCCCCGTCGGACTTGTGGCCGAGC
 
. : . : . : . : . : . :
JMSF037C24+ TCGCGGGTGAGCTGGAAAACCCTGGCGGCGCAGAGCGCCGGCATGCGGATGCGCCGCCCC
JMSF048B18+ TCGCGGGTGAGCTGGAAAACCCTGGCGGCGCAGAGCGCCGGCATGCGGATGCGCCGCCCC
                      ____________________________________________________________
consensus TCGCGGGTGAGCTGGAAAACCCTGGCGGCGCAGAGCGCCGGCATGCGGATGCGCCGCCCC
 
. : . : . : . : . : . :
JMSF037C24+ CGCCCGTCCACCTTCGTGTGCCGGTCCTTCGTCGACGTCCGCTTCGGCGGCGGCTTCTTC
JMSF048B18+ CGCCCGTCCACCTTCGTGTGCCGGTCCTTCGTCGACGTCCGCTTCGGCGGCGGCTTCTTC
                      ____________________________________________________________
consensus CGCCCGTCCACCTTCGTGTGCCGGTCCTTCGTCGACGTCCGCTTCGGCGGCGGCTTCTTC
 
. : . : . : . : . : . :
JMSF037C24+ GACGGCTCCGCCAAAGCAGCGGAGTCGGAGACGGCGGCGGAGGCGGAGGTGGATCGAGCT
JMSF048B18+ GACGGCTCCGCCAAAGCAGCGGAGTCGGAGACGGCGGCGGAGGCGGAGGTGGATCGAGCT
                      ____________________________________________________________
consensus GACGGCTCCGCCAAAGCAGCGGAGTCGGAGACGGCGGCGGAGGCGGAGGTGGATCGAGCT
 
. : . : . : . : . : . :
JMSF037C24+ GCAGCGGCGTTAGGGTTTGCGCTGGTATCCAGGGAGGAAGAGATTGCGAGAGAAGGATAA
JMSF048B18+ GCAGCGGCGTTAGGGTTTGCGCTGGTATCCAGGGAGGAAGAGATTGCGAGAGAAGGATAA
JMSF006E03+ GGAAGAGATTGCGAGAGAAGGATAA
                      ____________________________________________________________
consensus GCAGCGGCGTTAGGGTTTGCGCTGGTATCCAGGGAGGAAGAGATTGCGAGAGAAGGATAA
 
. : . : . : . : . : . :
JMSF037C24+ GGGACGATGGCGGTGGCGGAGGAAGAGCTGCTGGAGCATGCTTCGTCTTCTTTCTTCTCA
JMSF048B18+ GGGACGATGGCGGTGGCGGAGGAAGAGCTGCTGGAGCATGCTCCGTCTTCTTTCTTCTCA
JMSF006E03+ GGGACGATGGCGGTGGCGGAGGAAGAGCTGCTGGAGCATGCTTCGTCTTCTTTCTTCTCA
                      ____________________________________________________________
consensus GGGACGATGGCGGTGGCGGAGGAAGAGCTGCTGGAGCATGCTTCGTCTTCTTTCTTCTCA
 
. : . : . : . : . : . :
JMSF037C24+ AGCAATTGGAACGGAAAAGTTGGCCGGCGATTATGGTGGTGGTGGTGGAGATGATCATCA
JMSF048B18+ AGCAATTGGAACGGAAAAGTTGGCCGGCGATTATGGTGGTGGTGGTGGAGATGATCATCA
JMSF006E03+ AGCAATTGGAACGGAAAAGTTGGCCGGCGATTATGGTGGTGGTGGTGGAGATGATCATCA
                      ____________________________________________________________
consensus AGCAATTGGAACGGAAAAGTTGGCCGGCGATTATGGTGGTGGTGGTGGAGATGATCATCA
 
. : . : . : . : . : . :
JMSF037C24+ CCTCCTCGTTCCATGATC
JMSF048B18+ CCTCCTCGTTCCATGATCACATGCGTGACTGAATAATAGATATATAAATCTATCTAAACA
JMSF006E03+ CCTCCTCGTTCCATGATCACATGCGTGACTGAATAATAGATATATAAATCTATCTAAACA
                      ____________________________________________________________
consensus CCTCCTCGTTCCATGATCACATGCGTGACTGAATAATAGATATATAAATCTATCTAAACA
 
. : . : . : . : . : . :
JMSF048B18+ TACACTACTGAAAAACCTTTCTATTTCTCTTTCTCTTTTCTCTCTCAATATTTTTTTTAT
JMSF006E03+ TACACTACTGAAAAACCTTTCTATTTCTCTTTCTCTTTTCTCTCTCAATATTTTTTTTAT
                      ____________________________________________________________
consensus TACACTACTGAAAAACCTTTCTATTTCTCTTTCTCTTTTCTCTCTCAATATTTTTTTTAT
 
. : . : . : . : . : . :
JMSF048B18+ ATTTTTTATTTTAAAGATAGAAACAGCGACAAAACCTTATTAAATTCTTGTGGGCTCTCT
JMSF006E03+ ATTTTTTATTTTAAAGATAGAAACAGCGACAAAACCTTATTAAATTCTTGTGGGCTCTCT
                      ____________________________________________________________
consensus ATTTTTTATTTTAAAGATAGAAACAGCGACAAAACCTTATTAAATTCTTGTGGGCTCTCT
 
. : . : . : . : . : . :
JMSF048B18+ CACTCTCTCTCCCTCTCTGGAGAATGAAATTATTTCCTTAGTTGCGTTTAGCTTCTC
JMSF006E03+ CACTCTCTCTCCCTCTCTGGAGAATGAAATTATTTCCTTAGTTGCGTTTAGCTTCTCTCC
                      ____________________________________________________________
consensus CACTCTCTCTCCCTCTCTGGAGAATGAAATTATTTCCTTAGTTGCGTTTAGCTTCTCTCC