Previous Contig 004775:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014N03Sequence554004775 (4)727008894 (5)gb:AY050459_15622331e-29Arabidopsis thaliana AT4g36870/C7A10_490 mRNA, complete cds.>gb:AF173816_1774456
JMFF024E13Sequence433004775 (4)688008894 (5)gb:AY050459_15622332e-24Arabidopsis thaliana AT4g36870/C7A10_490 mRNA, complete cds.>gb:AF173816_1774456
JMSF006C02Sequence177004775 (4)359008894 (5)
JMSF018M06Sequence197004775 (4)756008894 (5)gb:AF406699_17969077e-37Solanum tuberosum BEL1-related homeotic protein 13 (Bel13) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014N03+ TTCAACGACAACGAA
                      ____________________________________________________________
consensus TTCAACGACAACGAA
 
. : . : . : . : . : . :
JMFF014N03+ AGCCCTTGATGAGCTTCTTCCATGGTTATCAGCGGACTAACAACTTGGAATCCTTGATGG
                      ____________________________________________________________
consensus AGCCCTTGATGAGCTTCTTCCATGGTTATCAGCGGACTAACAACTTGGAATCCTTGATGG
 
. : . : . : . : . : . :
JMFF024E13+ GTGCAGTACGAGGT
JMFF014N03+ ATAAGGTTGGATTCCGGTGATAGATCGGTGCCGGCTAACGTAAACGGTGCAGTACGAGGT
                      ____________________________________________________________
consensus ATAAGGTTGGATTCCGGTGATAGATCGGTGCCGGCTAACGTAAACGGTGCAGTACGAGGT
 
. : . : . : . : . : . :
JMFF024E13+ GGTGGGGAGGAGCTGGGTTTGACATGGATAAGATTCATCAATGGAAGTGCTTGGTTTAAT
JMFF014N03+ GGTGGGGAGGAGCTGGGTTTGACATGGATAAGATTCATCAATGGAAGTGCTTGGTTTAAT
                      ____________________________________________________________
consensus GGTGGGGAGGAGCTGGGTTTGACATGGATAAGATTCATCAATGGAAGTGCTTGGTTTAAT
 
. : . : . : . : . : . :
JMFF024E13+ GAGAGTGGATTATCTTTCTGAGGCCATGATCTGCCGCCATAGCTGGAAGCTTGGATCTGC
JMFF014N03+ GAGAGTGGATTATCTTTCTGAGGCCATGATCTGCCGCCATAGCTGGAAGCTTGGATCTGC
                      ____________________________________________________________
consensus GAGAGTGGATTATCTTTCTGAGGCCATGATCTGCCGCCATAGCTGGAAGCTTGGATCTGC
 
. : . : . : . : . : . :
JMFF024E13+ TCTTCCAGAACTTGTGCGGCGGATTTCCGCCACGCAGACCGGTAGTTGTCCACCATCTCC
JMFF014N03+ TCTTCCAGAACTTGTGCGGCGGATTTCCGCCACGCAGACCGGTAGTTGTCCACCATCTCC
                      ____________________________________________________________
consensus TCTTCCAGAACTTGTGCGGCGGATTTCCGCCACGCAGACCGGTAGTTGTCCACCATCTCC
 
. : . : . : . : . : . :
JMFF024E13+ GCCAGCATTCCGCCGTTGGAGTCATCACATCCCGGTGGCGCGTCTCCTTCAAACCCTCCA
JMFF014N03+ GCCAGCATTCCGCCGTTGGAGTCATCACATCCCGGTGGCGCGTCTCCTTCAAACCCTCCA
                      ____________________________________________________________
consensus GCCAGCATTCCGCCGTTGGAGTCATCACATCCCGGTGGCGCGTCTCCTTCAAACCCTCCA
 
. : . : . : . : . : . :
JMFF024E13+ TGAATTCTCATCATCATCTCTCTGAGAGAGAAGAAGCAGGTTAGATGGAGATTGATGATA
JMFF014N03+ TGAATTCTCATCATCATCTCTCTGAGAGAGAAGAAGCAGGTTAGATGGAGATTGATGATA
JMSF018M06+ CTGAGAGAGAAGAAGCAGGTTAGATGGAGATTGATGATA
JMSF006C02+ CTGAGAGAGAAGAAGCAGGTTAGATGGAGATTGATGATA
                      ____________________________________________________________
consensus TGAATTCTCATCATCATCTCTCTGAGAGAGAAGAAGCAGGTTAGATGGAGATTGATGATA
 
. : . : . : . : . : . :
JMFF024E13+ CAGACATCATTTGATCATGGATAAACAGCTTTCTGGGCATAGAGAGTTTGATGATTGATA
JMFF014N03+ CAGACATCATTTGATCATGGATAAACAGCTTTCTGGGCATAGAGAGTTTGATGATTGATA
JMSF018M06+ CAGACATCATTTGATCATGGATAAACAGCTTTCTGGGCATAGAGAGTTTGATGATTGATA
JMSF006C02+ CAGACATCATTTGATCATGGATAAACAGCTTTCTGGGCATAGAGAGTTTGATGATTGATA
                      ____________________________________________________________
consensus CAGACATCATTTGATCATGGATAAACAGCTTTCTGGGCATAGAGAGTTTGATGATTGATA
 
. : . : . : . : . : . :
JMFF024E13+ GATCTTTCATGGAAAACTTTTCTCTCAATCAAACAAGAAACAAAGCTTGCAGGCAGC
JMFF014N03+ GATCTTTCATGGAAAACTTTTCTCTCAATCAAACAAGAAACAAAGCTTGCAGGCAGC
JMSF018M06+ GATCTTTCATGGAAAACTTTTCTCTCAATCAAACAAGAAACAAAGCTTGCAGGCAGC
JMSF006C02+ GATCTTTCATGGAAAACTTTTCTCTCAATCAAACAAGAAACAAAGCTTGCAGGCAGCTGC
                      ____________________________________________________________
consensus GATCTTTCATGGAAAACTTTTCTCTCAATCAAACAAGAAACAAAGCTTGCAGGCAGCTGC