Previous Contig 004771:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I02Sequence335004771 (3)gb:S74753_17045034e-20mybSt1=Myb-related transcriptional activator [Solanum tuberosum=potatoes, leaf, 781020681gb:S74753_17045035e-45mybSt1=Myb-related transcriptional activator [Solanum tuberosum=potatoes, leaf,
JMFN028A05Sequence613004771 (3)gb:S74753_17045032e-75mybSt1=Myb-related transcriptional activator [Solanum tuberosum=potatoes, leaf,
JMSF006B20Sequence317004771 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028A05+ CTGGAGCGCCTTTTACGCCTCGATACATTACTTGCCTGANTAAAATATTT
                      ____________________________________________________________
consensus CTGGAGCGCCTTTTACGCCTCGATACATTACTTGCCTGANTAAAATATTT
 
. : . : . : . : . : . :
JMFN028A05+ TTGAGCGTGGCTTGCAACTTGAGTAGGTGTTCTTGAAACCACATAATTGCGAGCAATTCC
                      ____________________________________________________________
consensus TTGAGCGTGGCTTGCAACTTGAGTAGGTGTTCTTGAAACCACATAATTGCGAGCAATTCC
 
. : . : . : . : . : . :
JMFN028A05+ ACCCCAATCACCTTTTCCAAGCTTTTGTAGACCAAGAAGAAACATCCTATGTTCCTCTTC
                      ____________________________________________________________
consensus ACCCCAATCACCTTTTCCAAGCTTTTGTAGACCAAGAAGAAACATCCTATGTTCCTCTTC
 
. : . : . : . : . : . :
JMFN028A05+ GGTCCATGGAACACCTTTCTTTCTTTCGCGACTGGAGGAGGATCCAGGAACGAAGTCCTC
                      ____________________________________________________________
consensus GGTCCATGGAACACCTTTCTTTCTTTCGCGACTGGAGGAGGATCCAGGAACGAAGTCCTC
 
. : . : . : . : . : . :
JMFN028A05+ GGAGGCATAGCCATCAGCGGCGGCGGCGGCGGCGGGATGATCCGGCGTATCCCCGGGGGA
                      ____________________________________________________________
consensus GGAGGCATAGCCATCAGCGGCGGCGGCGGCGGCGGGATGATCCGGCGTATCCCCGGGGGA
 
. : . : . : . : . : . :
JMFN028A05+ ATCATGGGCGATACCATTGTGGGGAGTAGTGGAGCCGGCGCCGCCGTTACCGGCGGCATA
JMFF002I02+ GCATA
                      ____________________________________________________________
consensus ATCATGGGCGATACCATTGTGGGGAGTAGTGGAGCCGGCGCCGCCGTTACCGGCGGCATA
 
. : . : . : . : . : . :
JMFN028A05+ GTGGGTCAAGTTACCCATACTCGCACTCTTCCGGATCGACCCATCCGTCAATCGAACCCC
JMFF002I02+ GTGGGTCAAGTTACCCATACTCGCACTCTTCCGGATCGACCCATCCGTCAATCGAACCCC
                      ____________________________________________________________
consensus GTGGGTCAAGTTACCCATACTCGCACTCTTCCGGATCGACCCATCCGTCAATCGAACCCC
 
. : . : . : . : . : . :
JMFN028A05+ GAAGAGCTTGACCCCGCGGTTGGGGCAAGTCCGCGAGTTGTGGCCGTTGTTGCTGCAATG
JMFF002I02+ GAAGAGCTTGACCCCGCGGTTGGGGCAAGTCCGCGAGTTGTGGCCGTTGTTGCTGCAATG
JMSF006B20+ CCGTTGTTGCTGCAATG
                      ____________________________________________________________
consensus GAAGAGCTTGACCCCGCGGTTGGGGCAAGTCCGCGAGTTGTGGCCGTTGTTGCTGCAATG
 
. : . : . : . : . : . :
JMFN028A05+ CGAGCACCGCCGCGTCATGGAGAGAATCCACCGCAAAACCGGATCGGATCAGATTACCGG
JMFF002I02+ CGAGCACCGCCGCGTCATGGAGAGAATCCACCGCAAAACCGGATCGGATCAGATTACCGG
JMSF006B20+ CGAGCACCGCCGCGTCATGGAGAGANTCCACCGCAAAACCGGATCGGATCAGATTACCGG
                      ____________________________________________________________
consensus CGAGCACCGCCGCGTCATGGAGAGAATCCACCGCAAAACCGGATCGGATCAGATTACCGG
 
. : . : . : . : . : . :
JMFN028A05+ GCGAGAAGATCCAACACTGATTTGTGACCCGACAACACACAGATTTCAGCTGCTCTGTTC
JMFF002I02+ GCGAGAAGATCCAACACTGATTTGTGACCCGACAACACACAGATTTCAGCTGCTCTGTTC
JMSF006B20+ GCGAGAAGATCCAACACTGATTTGTGACCCGACAACACACAGATTTCAGCTGCTCTGTTC
                      ____________________________________________________________
consensus GCGAGAAGATCCAACACTGATTTGTGACCCGACAACACACAGATTTCAGCTGCTCTGTTC
 
. : . : . : . : . : . :
JMFN028A05+ TCACATGATCCGAAACAGACAGC
JMFF002I02+ TCACATGATCCGAAACAGACAGCAAAAAGGGGTTTGGGCTTCCGGGAGGGCAGTTTTTGG
JMSF006B20+ TCACATGATCCGAAACAGACAGCAAAAAGGGGTTTGGGCTTCCGGGAGGGCAGTTTTTGG
                      ____________________________________________________________
consensus TCACATGATCCGAAACAGACAGCAAAAAGGGGTTTGGGCTTCCGGGAGGGCAGTTTTTGG
 
. : . : . : . : . : . :
JMFF002I02+ ATTGAAGTGCCTTTGCGCTATAAACGAAGC
JMSF006B20+ ATTGAAGTGCCTTTGCGCTATAAACGAAGCAAGGCTGTATGGATATATTATAGATATAGA
                      ____________________________________________________________
consensus ATTGAAGTGCCTTTGCGCTATAAACGAAGCAAGGCTGTATGGATATATTATAGATATAGA
 
. : . : . : . : . : . :
JMSF006B20+ TATATAGATATAGAGAGAGAGAAAGAGAGAGAGAAGGCGGAACACGGAAATGACTTACTC
                      ____________________________________________________________
consensus TATATAGATATAGAGAGAGAGAAAGAGAGAGAGAAGGCGGAACACGGAAATGACTTACTC