Previous Contig 004761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M12Sequence552004761 (5)gb:LES011418_16844566e-62Lycopersicon esculentum mRNA for ubiquitin activating enzyme.698008645 (8)gb:LES011418_16844563e-46Lycopersicon esculentum mRNA for ubiquitin activating enzyme.
JMFF010F21Sequence534004761 (5)gb:LES011418_16844561e-55Lycopersicon esculentum mRNA for ubiquitin activating enzyme.777008645 (8)gb:AY072375_15671922e-49Arabidopsis thaliana ubiquitin activating enzyme - like protein (At4g24940) mRNA
JMSF005O21Sequence265004761 (5)gb:LES011418_16844569e-15Lycopersicon esculentum mRNA for ubiquitin activating enzyme.449008645 (8)gb:AY072375_15671922e-19Arabidopsis thaliana ubiquitin activating enzyme - like protein (At4g24940) mRNA
JMSF006A09Sequence248004761 (5)gb:LES011418_16844561e-14Lycopersicon esculentum mRNA for ubiquitin activating enzyme.299011363 (4)
JMSF006G02Sequence386004761 (5)gb:LES011418_16844563e-41Lycopersicon esculentum mRNA for ubiquitin activating enzyme.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF009M12+ TAACATCCACGGCATAAAAAGCAATGCGCTTTGACAACTTTCGACACT
JMFF010F21+ ACT
                      ____________________________________________________________
consensus TAACATCCACGGCATAAAAAGCAATGCGCTTTGACAACTTTCGACACT
 
. : . : . : . : . : . :
JMFF009M12+ TTGCATTTACAGATTTCTTTGTTGAAAGAGAGCAGTGGCTGATAACAACAGCGTCAAACT
JMFF010F21+ TTGCATTTACAGATTTCTTTGTTGAAAGAGAGCAGTGGCTGATAACAACAGCGTCAAACT
                      ____________________________________________________________
consensus TTGCATTTACAGATTTCTTTGTTGAAAGAGAGCAGTGGCTGATAACAACAGCGTCAAACT
 
. : . : . : . : . : . :
JMFF009M12+ TATCAAAGAAATCAGCATCAAAACTTGACAAATCACCTTTTTGGACAGAAACATAAACCA
JMFF010F21+ TATCAAAGAAATCAGCATCAAAACTTGACAAATCACCTTTTTGGACAGAAACATAAACCA
                      ____________________________________________________________
consensus TATCAAAGAAATCAGCATCAAAACTTGACAAATCACCTTTTTGGACAGAAACATAAACCA
 
. : . : . : . : . : . :
JMFF009M12+ TAGGGTTGAATTCTTTCAAAGAATCACAACAGAGCTCGGCAACAGATTTCCCACCGAAAA
JMFF010F21+ TAGGGTTGAATTCTTTCAAAGAATCACAACAGAGCTCGGCAACAGATTTCCCACCTAAAA
                      ____________________________________________________________
consensus TAGGGTTGAATTCTTTCAAAGAATCACAACAGAGCTCGGCAACAGATTTCCCACCTAAAA
 
. : . : . : . : . : . :
JMFF009M12+ CATTTTCATCTGGGGGAATGAGGAAATTAGCAGAAAGTAATTCCTCGGTCACCATGCGAT
JMFF010F21+ CATTTTCATCTGGGGGAATGAGGAAATTAGCAGAAAGTAATTCCTCGGTCACCATGCGAT
                      ____________________________________________________________
consensus CATTTTCATCTGGGGGAATGAGGAAATTAGCAGAAAGTAATTCCTCGGTCACCATGCGAT
 
. : . : . : . : . : . :
JMFF009M12+ CATCATTCAGCGTCAAACTACCAACTCCAGCTAAAACAATATTTTTGCAGAACTCTACAG
JMSF006G02+ CTCTACAG
JMSF005O21+ CTCTACAG
JMFF010F21+ CATCATTCAGCGTCAAACTACCAACTCCAGCTAAAACAATATTTTTGCAGAACTCTACAG
JMSF006A09+ CTCTACAG
                      ____________________________________________________________
consensus CATCATTCAGCGTCAAACTACCAACTCCAGCTAAAACAATATTTTTGCAGAACTCTACAG
 
. : . : . : . : . : . :
JMFF009M12+ CAGTCCCTTTGAGTCCACTGACAAACACATGAGCTTTACTGAGGCGTCTTTGAGCATCAA
JMSF006G02+ CAGTCCCTTTGAGTCCACTGACAAACACATGAGCTTTACTGAGGCGTCTTTGAGCATCAA
JMSF005O21+ CAGTCCCTTTGAGTCCACTGACAAACACATGAGCTTTACTGAGGCGTCTTTGAGCATCAA
JMFF010F21+ CAGTCCCTTTGAGTCCACTGACAAACACATGAGCTTTACTGAGGCGTCTTTGAGCATCAA
JMSF006A09+ CAGTCCCTTTGAGTCCACTGACAAACACATGAGCTTTACTGAGGCGTCTTTGAGCATCAA
                      ____________________________________________________________
consensus CAGTCCCTTTGAGTCCACTGACAAACACATGAGCTTTACTGAGGCGTCTTTGAGCATCAA
 
. : . : . : . : . : . :
JMFF009M12+ CGCCCCAGACCCTAATCTGACGATCGTAGATGGCAGTTTCCTGCTCTGTCAACTCCGCTC
JMSF006G02+ CGCCCCAGACCCTAATCTGACGATCGTAGATGGCAGTTTCCTGCTCTGTCAACTCCGCTC
JMSF005O21+ CGCCCCAGACCCTAATCTGACGATCGTAGATGGCAGTTTCCTGCTCTGTCAACTCCGCTC
JMFF010F21+ CGCCCCAGACCCTAATCTGACGATCGTAGATGGCAGTTTCCTGCTCTGTCAACTCCGCTC
JMSF006A09+ CGCCCCAGACCCTAATCTGACGATCGTAGATGGCAGTTTCCTGCTCTGTCAACTCCGCTC
                      ____________________________________________________________
consensus CGCCCCAGACCCTAATCTGACGATCGTAGATGGCAGTTTCCTGCTCTGTCAACTCCGCTC
 
. : . : . : . : . : . :
JMFF009M12+ GCTCCATATTCCCGAACAAAACAGCTGTAAGAATCAAGAGTTGAGGGTAGTGCGAACCGT
JMSF006G02+ GCTCCATATTCCCGAACAAAACAGCTGTAAGAATCAAGAGTTGAGGGTAGTGCGAACCGT
JMSF005O21+ GCTCCATATTCCCGAACAAAACAGCTGTAAGAATCAAGAGTTGAGGGTAGTGCGAACCGT
JMFF010F21+ GCTCCATATTCCCGAACAAAACAGCTGTAAGAATCAAGAGTTGAGGGTAGTGCGAACCGT
JMSF006A09+ GCTCCATATTCCCGAACAAAACAGCTGTAAGAATCAAGAGTTGAGGGTAGTGCGAACCGT
                      ____________________________________________________________
consensus GCTCCATATTCCCGAACAAAACAGCTGTAAGAATCAAGAGTTGAGGGTAGTGCGAACCGT
 
. : . : . : . : . : . :
JMFF009M12+ CTTCTTCCTTAGGCTC
JMSF006G02+ CTTCTTCCTTAGGCTCCTTGCTCGACAAGTCGACAGTTGCCCTCT
JMSF005O21+ CTTCTTCCTTAGGCTCCTTGCTCGACAAGTCGACAGTTGCCCTCT
JMFF010F21+ CTTCTTCCTTAGGCTCCTTGCTCGACAAGTCGACAGTTGCCCTCTATCCGT
JMSF006A09+ CTTCTTCCTTAGGCTCCTTGCTCGACAAGTCGACAGTTGCCCTCTATCCGTGATTTTCCC
                      ____________________________________________________________
consensus CTTCTTCCTTAGGCTCCTTGCTCGACAAGTCGACAGTTGCCCTCTATCCGTGATTTTCCC