Previous Contig 004760:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN002E07Sequence631004760 (5)
JMFN010G14Sequence625004760 (5)
JMFN037E22Sequence598004760 (5)
JMSF005P22Sequence301004760 (5)405004760 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF005P22- ACACCGGTGAGACGGATATCAAAAACGAATTAAAGCATCTAATCTCCT
                      ____________________________________________________________
consensus ACACCGGTGAGACGGATATCAAAAACGAATTAAAGCATCTAATCTCCT
 
. : . : . : . : . : . :
rJMSF005P22- CAATCGCTGTGATCAACACCGTCAAAATCAATGAATATAAAAAATTCAATGAAATATAGA
JMFN010G14+ TCGCTGTGATCAACACCGTCAAAATCAATGAATATAAAAAATTCAATGAAATATAGA
JMFN037E22+ ATCAATGAATATAAAAAATTCAATGAAATATAGA
JMFN002E07+ ATCAATGAATATAAAAAATTCAATGAAATATAGA
                      ____________________________________________________________
consensus CAATCGCTGTGATCAACACCGTCAAAATCAATGAATATAAAAAATTCAATGAAATATAGA
 
. : . : . : . : . : . :
rJMSF005P22- TATATAGAGCCCTAAATCATCAACTCCGGTGTATGTGAAAAGAATCTCAGGCACATCAGA
JMFN010G14+ TATATAGAGCCCTAAATCATCAACTCCGGTGTATGTGAAAAGAATCTCAGGCACATCAGA
JMFN037E22+ TATATAGAGCCCTAAATCATCAACTCCGGTGTATGTGAAAAGAATCTCAGGCACATCAGA
JMFN002E07+ TATATAGAGCCCTAAATCATCAACTCCGGTGTATGTGAAAAGAATCTCAGGCACATCAGA
                      ____________________________________________________________
consensus TATATAGAGCCCTAAATCATCAACTCCGGTGTATGTGAAAAGAATCTCAGGCACATCAGA
 
. : . : . : . : . : . :
rJMSF005P22- GAATTTAAAACAGCAAAGCGGCAGCGACGAACGCCAAACCAGCAGATCCGACGAGAGCGA
JMFN010G14+ GAATTTAAAACAGCAAAGCGGCAGCGACGAACGCCAAACCAGCAGATCCGACGAGAGCGA
JMFN037E22+ GAATTTAAAACAGCAAAGCGGCAGCGACGAACGCCAAACCAGCAGATCCGACGAGAGCGA
JMFN002E07+ GAATTTAAAACAGCAAAGCGGCAGCGACGAACGCCAAACCAGCAGATCCGACGAGAGCGA
                      ____________________________________________________________
consensus GAATTTAAAACAGCAAAGCGGCAGCGACGAACGCCAAACCAGCAGATCCGACGAGAGCGA
 
. : . : . : . : . : . :
rJMSF005P22- CTCTGTTCAAAGCGGCGGCGTTGGGAGGGGAGGAAGGAGCATCGCTTCCGGGAGCCTGTG
JMFN010G14+ CTCTGTTCAAAGCGGCGGCGTTGGGAGGGGAGGAAGGAGCATCGCTTCCGGGAGCCTGTG
JMFN037E22+ CTCTGTTCAAAGCGGCGGCGTTGGGAGGGGAGGAAGGAGCATCGCTTCCGGGAGCCTGTG
JMFN002E07+ CTCTGTTCAAAGCGGCGGCGTTGGGAGGGGAGGAAGGAGCATCGCTTCCGGGAGCCTGTG
                      ____________________________________________________________
consensus CTCTGTTCAAAGCGGCGGCGTTGGGAGGGGAGGAAGGAGCATCGCTTCCGGGAGCCTGTG
 
. : . : . : . : . : . :
rJMSF005P22- AGATGGATGGAGGATTAGCAACGGTGGAGGCGGGGGAGACGGCAGGAGTGCCGGTGGGAG
JMFN010G14+ AGATGGATGGAGGATTAGCAACGGTGGAGGCGGGGGAGACGGCAGGAGTGCCGGTGGGAG
JMFN037E22+ AGATGGATGGAGGATTAGCAACGGTGGAGGCGGGGGAGACGGCAGGAGTGCCGGTGGGAG
JMFN002E07+ AGATGGATGGAGGATTAGCAACGGTGGAGGCGGGGGAGACGGCAGGAGTGCCGGTGGGAG
                      ____________________________________________________________
consensus AGATGGATGGAGGATTAGCAACGGTGGAGGCGGGGGAGACGGCAGGAGTGCCGGTGGGAG
 
. : . : . : . : . : . :
rJMSF005P22- GAGCCGGTGGAGAANAGAGTGGTGACTCANAAGGAGCGGCGGCAGATGGAGTCTGAG
JMFN010G14+ GAGCCGGTGGAGAAGAGAGTGGTGACTCAGAAGGAGCGGCGGCAGATGGAGTCTGAGCCG
JMFN037E22+ GAGCCGGTGGAGAAGAGAGTGGTGACTCAGAAGGAGCGGCGGCAGATGGAGTCTGAGCCG
JMFN002E07+ GAGCCGGTGGAGAAGAGAGTGGTGACTCAGAAGGAGCGGCGGCAGATGGAGTCTGAGCCG
JMSF005P22+ G
                      ____________________________________________________________
consensus GAGCCGGTGGAGAAGAGAGTGGTGACTCAGAAGGAGCGGCGGCAGATGGAGTCTGAGCCG
 
. : . : . : . : . : . :
JMFN010G14+ GAGAGGACGCTGGAGAAGAACGCGGTGCCGCCGGCACTGCCTGCGGCGGAGACGCCACCG
JMFN037E22+ GAGAGGACGCTGGAGAAGAACGCGGTGCCGCCGGCACTGCCTGCGGCGGAGACGCCACCG
JMFN002E07+ GAGAGGACGCTGGAGAAGAACGCGGTGCCGCCGGCACTGCCTGCGGCGGAGACGCCACCG
JMSF005P22+ GAGAGGACGCTGGAGAAGAACGCGGTGCCGCCGGCACTGCCTGCGGCGGAGACGCCACCG
                      ____________________________________________________________
consensus GAGAGGACGCTGGAGAAGAACGCGGTGCCGCCGGCACTGCCTGCGGCGGAGACGCCACCG
 
. : . : . : . : . : . :
JMFN010G14+ GAGATGGAGATCTCTTCGGTGAAGCAGCTGGTGCAGCTCCTGGAGCCTGAGCAAAGGCAG
JMFN037E22+ GAGATGGAGATCTCTTCGGTGAAGCAGCTGGTGCAGCTCCTGGAGCCTGAGCAAAGGCAG
JMFN002E07+ GAGATGGAGATCTCTTCGGTGAAGCAGCTGGTGCAGCTCCTGGAGCCTGAGCAAAGGCAG
JMSF005P22+ GAGATGGAGATCTCTTCGGTGAAGCAGCTGGTGCAGCTCCTGGAGCCTGAGCAAAGGCAG
                      ____________________________________________________________
consensus GAGATGGAGATCTCTTCGGTGAAGCAGCTGGTGCAGCTCCTGGAGCCTGAGCAAAGGCAG
 
. : . : . : . : . : . :
JMFN010G14+ ATCCAGCCATCAAGGCCAACATCATAACAACAACAACTCTCAAGTAAGCCATTTTTCTAC
JMFN037E22+ ATCCAGCCATCAAGGCCAACATCATAACAACAACAACTCTCAAGTAAGCCATTTTTCTAC
JMFN002E07+ ATCCAGCCATCAAGGCCAACATCATAACAACAACAACTCTCAAGTAAGCCATTTTTCTAC
JMSF005P22+ ATCCAGCCATCAAGGCCAACATCATAACAACAACAACTCTCAAGTAAGCCATTTTTCTAC
                      ____________________________________________________________
consensus ATCCAGCCATCAAGGCCAACATCATAACAACAACAACTCTCAAGTAAGCCATTTTTCTAC
 
. : . : . : . : . : . :
JMFN010G14+ TCAAACTATAATTCAAGTTCAACAAACTTCGCTTCTGTTTGCAGAGAAATCGAAATCGTA
JMFN037E22+ TCAAACTATAATTCAAGTTCAACAAACTTCGCTTCTGTTTGCAGAGAAATCGAAATCGTA
JMFN002E07+ TCAAACTATAATTCAAGTTCAACAAACTTCGCTTCTGTTTGCAGAGAAATCGAAATCGTA
JMSF005P22+ TCAAACTATAATTCAAGTTCAACAAACTTCGCTTCTGTTTGCAGAGAAATCGAAATCGTA
                      ____________________________________________________________
consensus TCAAACTATAATTCAAGTTCAACAAACTTCGCTTCTGTTTGCAGAGAAATCGAAATCGTA
 
. : . : . : . : . : . :
JMFN010G14+ TGTATAGGCAGAGCCGCAGAGAGA
JMFN037E22+ TGTATAGGCAGAGCCGCAGAGAGA
JMFN002E07+ TGTATAGGCAGAGCCGCAGAGAGAGAAATATCTGTGAAT
JMSF005P22+ TGTATAGGCAGAGCCGCAGAGAGAGAAATATCTGTGAATGAAGAGATGAGTGAATGGGTC
                      ____________________________________________________________
consensus TGTATAGGCAGAGCCGCAGAGAGAGAAATATCTGTGAATGAAGAGATGAGTGAATGGGTC