Previous Contig 004756:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036I01Sequence544004756 (2)pir|T07739|T077397e-31probable ferrochelatase (EC 4.99.1.1) - potato>gb:STU5802_1723115 Solanum tubero714009911 (2)gb:AB037113_15190921e-34Cucumis sativus hemH mRNA for ferrochelatase, complete cds.
JMSF005P08Sequence226004756 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036I01+ TAGCA
                      ____________________________________________________________
consensus TAGCA
 
. : . : . : . : . : . :
JMFF036I01+ ACTGATATGAATTGAGCCAAGGGCTTTTGCAGAAACCTGAACAGCCTCGGCAATCGAATT
                      ____________________________________________________________
consensus ACTGATATGAATTGAGCCAAGGGCTTTTGCAGAAACCTGAACAGCCTCGGCAATCGAATT
 
. : . : . : . : . : . :
JMFF036I01+ ATATCCGGATCAGCAAAGAGGTTAAACAAAAAAGGCTGTACGTCCTCGAGAGTTTCAGGA
                      ____________________________________________________________
consensus ATATCCGGATCAGCAAAGAGGTTAAACAAAAAAGGCTGTACGTCCTCGAGAGTTTCAGGA
 
. : . : . : . : . : . :
JMFF036I01+ CCGCCGAGGTTGAGCAGCAAAACACCGATCTTTTCCCCTGCAACGAGGGGAGCGGTGGAT
                      ____________________________________________________________
consensus CCGCCGAGGTTGAGCAGCAAAACACCGATCTTTTCCCCTGCAACGAGGGGAGCGGTGGAT
 
. : . : . : . : . : . :
JMFF036I01+ ACTTGCTGAACAGTGGAAGTAACTAGCGATTGTTCAGCGGAAACCACAGAACACCTAGCG
                      ____________________________________________________________
consensus ACTTGCTGAACAGTGGAAGTAACTAGCGATTGTTCAGCGGAAACCACAGAACACCTAGCG
 
. : . : . : . : . : . :
JMFF036I01+ AGTAGAGAAGATGATTTGGGCCTCGGATGTGGCTGAAATTTAGGTCTGAAGCAATGACAA
                      ____________________________________________________________
consensus AGTAGAGAAGATGATTTGGGCCTCGGATGTGGCTGAAATTTAGGTCTGAAGCAATGACAA
 
. : . : . : . : . : . :
JMFF036I01+ GAAGAAGAGGTTCTTTGAGAAGAGCAGAGAGAAACTGAGCGCGTCGGAAGCATTTGTTCG
JMSF005P08+ TTGAGAAGAGCAGAGAGAAACTGAGCGCGTCGGAAGCATTTGTTCG
                      ____________________________________________________________
consensus GAAGAAGAGGTTCTTTGAGAAGAGCAGAGAGAAACTGAGCGCGTCGGAAGCATTTGTTCG
 
. : . : . : . : . : . :
JMFF036I01+ GTCTTCGACGGCAGCCATGGGGAGTAGGTGACACTGTGCGGCGTCGATGGGGAAATCAAC
JMSF005P08+ GTCTTCGACGGCAGCCATGGGGAGTAGGTGACACTGTGCGGCGTCGATGGGGAAATCAAC
                      ____________________________________________________________
consensus GTCTTCGACGGCAGCCATGGGGAGTAGGTGACACTGTGCGGCGTCGATGGGGAAATCAAC
 
. : . : . : . : . : . :
JMFF036I01+ CGGCAGGTAACTCCTGGCGCCATGGCAGGTAAGGTAGAACTTCTGTGAGTGGAGATTCAC
JMSF005P08+ CGGCAGGTAACTCCTGGCGCCATGGCAGGTAAGGTAGAACTTCTGTGAGTGGAGATTCAC
                      ____________________________________________________________
consensus CGGCAGGTAACTCCTGGCGCCATGGCAGGTAAGGTAGAACTTCTGTGAGTGGAGATTCAC
 
. : . : . : . : . : . :
JMFF036I01+ TTCTGAATTTTTCGAAATAATTTAATCGCAAAAAATAATTGAAAAGAAAATGGAGGCTC
JMSF005P08+ TTCTGAATTTTTCGAAATAATTTAATCGCAAAAAATAATTGAAAAGAAAATGGAGGCTCC
                      ____________________________________________________________
consensus TTCTGAATTTTTCGAAATAATTTAATCGCAAAAAATAATTGAAAAGAAAATGGAGGCTCC