Previous Contig 004747:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005N04Sequence368004747 (2)420011332 (2)sp|O22478|IMA_LYCES6e-07Importin alpha subunit (Karyopherin alpha subunit) (KAP alpha).>pir|T04329|T0432
JMSF008C20Sequence368004747 (2)757011425 (2)gb:AY040076_15605735e-76Arabidopsis thaliana unknown protein (At3g54190) mRNA, complete cds.>gb:AF360263

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008C20+ TGTGCACA
JMSF005N04+ ATGTGCACA
                      ____________________________________________________________
consensus ATGTGCACA
 
. : . : . : . : . : . :
JMSF008C20+ GACATACTAGCTCCAACGCAACATTCCCGGCAGTGAAATAGACAACGGATTCGGGTTCCC
JMSF005N04+ GACATACTAGCTCCAACGCAACATTCCCGGCAGTGAAATAGACAACGGATTCGGGTTCCC
                      ____________________________________________________________
consensus GACATACTAGCTCCAACGCAACATTCCCGGCAGTGAAATAGACAACGGATTCGGGTTCCC
 
. : . : . : . : . : . :
JMSF008C20+ AATGTTAATTTCCCAGCGTTTTAAACCCTAAATCCTAAGACCCGGATACCAAAAATTAGG
JMSF005N04+ AATGTTAATTTCCCAGCGTTTTAAACCCTAAATCCTAAGACCCGGATACCAAAAATTAGG
                      ____________________________________________________________
consensus AATGTTAATTTCCCAGCGTTTTAAACCCTAAATCCTAAGACCCGGATACCAAAAATTAGG
 
. : . : . : . : . : . :
JMSF008C20+ GATTTTCTAGCCCGGGTTTCAGCTGGAAGAAAAAACAACACAGAAGATTGATAAGATGAG
JMSF005N04+ GATTTTCTAGCCCGGGTTTCAGCTGGAAGAAAAAACAACACAGAAGATTGATAAGATGAG
                      ____________________________________________________________
consensus GATTTTCTAGCCCGGGTTTCAGCTGGAAGAAAAAACAACACAGAAGATTGATAAGATGAG
 
. : . : . : . : . : . :
JMSF008C20+ AAGGCTCCCCGTATATGCTCGAACTGTGTGAATTTTCTCTCTCTATATGTATATATGCAT
JMSF005N04+ AAGGCTCCCCGTATATGCTCGAACTGTGTGAATTTTCTCTCTCTATATGTATATATGCAT
                      ____________________________________________________________
consensus AAGGCTCCCCGTATATGCTCGAACTGTGTGAATTTTCTCTCTCTATATGTATATATGCAT
 
. : . : . : . : . : . :
JMSF008C20+ GCAAAATCTCTCACTGAACACCAATCGGAAATTGAAGATGGGTCCGGGAGGATGACGGAC
JMSF005N04+ GCAAAATCTCTCACTGAACACCAATCGGAAATTGAAGATGGGTCCGGGAGGATGACGGAC
                      ____________________________________________________________
consensus GCAAAATCTCTCACTGAACACCAATCGGAAATTGAAGATGGGTCCGGGAGGATGACGGAC
 
. : . : . : . : . : . :
JMSF008C20+ GGGGGAACATCGGGGAACGGGTCGGATGTAAAACCAGTGGGACGTCCGATTTGATTTCCC
JMSF005N04+ GGGGGAACATCGGGGAACGGGTCGGATGTAAAA-CAGTGGGACGTCCGATTTGATTTCCC
                      ____________________________________________________________
consensus GGGGGAACATCGGGGAACGGGTCGGATGTAAAACCAGTGGGACGTCCGATTTGATTTCCC