Previous Contig 004746:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS039D10Sequence603004746 (4)gb:AC092076_17351834e-17Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence.
JMSF003M23Sequence357004746 (4)gb:AC092076_17351831e-04Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence.758011285 (2)pir|T04798|T047980.001hypothetical protein F10M23.90 - Arabidopsis thaliana>gb:ATCHRIV65_1546556 Arabi
JMSF005M21Sequence319004746 (4)gb:AC092076_17351839e-05Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence.373011285 (2)
JMSF041I24Sequence668004746 (4)gb:AC092076_17351832e-17Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence.620011187 (2)pir|S08207|S082071e-22sialoglycoprotein precursor RTG7-B - rainbow trout

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I24+ CCTTTAAAGTCT
                      ____________________________________________________________
consensus CCTTTAAAGTCT
 
. : . : . : . : . : . :
JMFS039D10+ TTGATTGGTACCACAGACTGAATTAACATGCCACATG
JMSF041I24+ TCGCCACAACACCACCTCCCTCCTTGATTGGTACCACAGACTGAATTAACATGCCACATG
                      ____________________________________________________________
consensus TCGCCACAACACCACCTCCCTCCTTGATTGGTACCACAGACTGAATTAACATGCCACATG
 
. : . : . : . : . : . :
JMFS039D10+ CTCGCCTCCTATCTGCCATTCCAGACTTCCCCTCTACCTTCATCCTCACATAGTCCTCAG
JMSF041I24+ CTCGCCTCCTATCTGCCATTCCAGACTTCCCCTCTACCTTCATCCTCACATAGTCCTCAG
                      ____________________________________________________________
consensus CTCGCCTCCTATCTGCCATTCCAGACTTCCCCTCTACCTTCATCCTCACATAGTCCTCAG
 
. : . : . : . : . : . :
JMFS039D10+ CAGCATCCAAAACCAACCTCATGGCGTCGACTGATTCTTTGACAGCATTAGGAATCTCAG
JMSF041I24+ CAGCATCCAAAACCAACCTCATGGCGTCGACTGATTCTTTGACAGCATTAGGAATCTCAG
                      ____________________________________________________________
consensus CAGCATCCAAAACCAACCTCATGGCGTCGACTGATTCTTTGACAGCATTAGGAATCTCAG
 
. : . : . : . : . : . :
JMFS039D10+ ATCGCAAAGCAGCGGAATCCCTCCGGTTCTGGAAAAGAAACTTCATGAGCCCACTGGCGT
JMSF041I24+ ATCGCAAAGCAGCGGAATCCCTCCGGTTCTGGAAAAGAAACTTCATGAGCCCACTGGCGT
                      ____________________________________________________________
consensus ATCGCAAAGCAGCGGAATCCCTCCGGTTCTGGAAAAGAAACTTCATGAGCCCACTGGCGT
 
. : . : . : . : . : . :
JMFS039D10+ CCATTCTTCTGCAGTAGAATCTCATCATCTCCGGCAAGCTCTTCTCCTTCAAATTCCCCG
JMSF003M23+ TTCTCCTTCAAATTCCCCG
JMSF041I24+ CCATTCTTCTGCAGTAGAATCTCATCATCTCCGGCAAGCTCTTCTCCTTCAAATTCCCCG
                      ____________________________________________________________
consensus CCATTCTTCTGCAGTAGAATCTCATCATCTCCGGCAAGCTCTTCTCCTTCAAATTCCCCG
 
. : . : . : . : . : . :
JMFS039D10+ CCGTATCGGGGCTCTCGATCTCCGCAATCGCCGCCGCCTTGAGCACCTCGACCCGGGCTG
JMSF003M23+ CCGTATCGGGGCTCTCGATCTCCGCAATCGCCGCCGCCTTGAGCACCTCGACCCGGGCTG
JMSF041I24+ CCGTATCGGGGCTCTCGATCTCCGCAATCGCCGCCGCCTTGAGCACCTCGACCCGGGCTG
JMSF005M21+ AGCACCTCGACCCGGGCTG
                      ____________________________________________________________
consensus CCGTATCGGGGCTCTCGATCTCCGCAATCGCCGCCGCCTTGAGCACCTCGACCCGGGCTG
 
. : . : . : . : . : . :
JMFS039D10+ CGATGGAAATCTCGCGTTCCGGGAAGCCATCCTCGCGATTCCTGAGGTCGGTGAGGGCAT
JMSF003M23+ CGATGGAAATCTCGCGTTCCGGGAAGCCATCCTCGCGATTCCTGAGGTCGGTGAGGGCAT
JMSF041I24+ CGATGGAAATCTCGCGTTCCGGGAAGCCATCCTCGCGATTCCTGAGGTCGGTGAGGGCAT
JMSF005M21+ CGATGGAAATCTCGCGTTCCGGGAAGCCATCCTCGCGATTCCTGAGGTCGGTGAGGGCAT
                      ____________________________________________________________
consensus CGATGGAAATCTCGCGTTCCGGGAAGCCATCCTCGCGATTCCTGAGGTCGGTGAGGGCAT
 
. : . : . : . : . : . :
JMFS039D10+ TATTGGTATTCTGCCGCAAGGAGCTGAACCGAGCGTCGAGGGTTTCGGATTTTCGGGAGA
JMSF003M23+ TATTGGTATTCTGCCGCAAGGAGCTGAACCGAGCGTCGAGGGTTTCGGATTTTCGGGAGA
JMSF041I24+ TATTGGTATTCTGCCGCAAGGAGCTGAACCGAGCGTCGAGGGTTTCGGATTTTCGGGAGA
JMSF005M21+ TATTGGTATTCTGCCGCAAGGAGCTGAACCGAGCGTCGAGGGTTTCGGATTTTCGGGAGA
                      ____________________________________________________________
consensus TATTGGTATTCTGCCGCAAGGAGCTGAACCGAGCGTCGAGGGTTTCGGATTTTCGGGAGA
 
. : . : . : . : . : . :
JMFS039D10+ GAGCTCGGTCGACGGCGGAGAAATGGGATGTTAGGGTTTTGTGGATGTCGGCGATGGTAG
JMSF003M23+ GAGCTCGGTCGACGGCGGAGAAATGGGATGTTAGGGTTTTGTGGATGTCGGCGATGGTAG
JMSF041I24+ GAGCTCGGTCGACGGCGGAGAAATGGGATGTTAGGGTTTTGTGGATGTCGGCGATGGTAG
JMSF005M21+ GAGCTCGGTCGACGGCGGAGAAATGGGATGTTAGGGTTTTGTGGATGTCGGCGATGGTAG
                      ____________________________________________________________
consensus GAGCTCGGTCGACGGCGGAGAAATGGGATGTTAGGGTTTTGTGGATGTCGGCGATGGTAG
 
. : . : . : . : . : . :
JMFS039D10+ ATAGTAGAGCTTTACGAGCCTCGAGCTTGGAGAAGAAGGATTGGATCGGTTCCGGGTTGA
JMSF003M23+ ATAGTAGAGCTTTACGAGCCTCGAGCTTGGAGAAGAAGGATTGGATCGGTTCCGGGTTGA
JMSF041I24+ ATAGTAGAGCTTTACGAGCCTCGAGCTTGGAGAAGAAGGATTGGATCGGTTCCGGGTTGA
JMSF005M21+ ATAGTAGAGCTTTACGAGCCTCGAGCTTGGAGAAGAAGGATTGGATCGGTTCCGGGTTGA
                      ____________________________________________________________
consensus ATAGTAGAGCTTTACGAGCCTCGAGCTTGGAGAAGAAGGATTGGATCGGTTCCGGGTTGA
 
. : . : . : . : . : . :
JMFS039D10+ TTGAGATTTCGGTAGCCATGGCAATA
JMSF003M23+ TTGAGATTTCGGTAGCCATGGCAATAGAGACTCCGGC
JMSF041I24+ TTGAGATTTCGGTAGCCATGGCAATAGAGACTCCGGCGAGTGTTTCAGTTCATCT
JMSF005M21+ TTGAGATTTCGGTAGCCATGGCAATAGAGACTCCGGCGAGTGTTTCAGTTCATCTAAATC
                      ____________________________________________________________
consensus TTGAGATTTCGGTAGCCATGGCAATAGAGACTCCGGCGAGTGTTTCAGTTCATCTAAATC