Previous Contig 004743:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004C21Sequence555004743 (33)gb:BT008775_16399713e-32Arabidopsis thaliana At4g24530 mRNA, complete cds.772004743 (33)gb:AF275345_17825264e-80Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF006H14Sequence584004743 (33)gb:AY093167_15751217e-41Arabidopsis thaliana unknown protein (At5g65470) mRNA, complete cds.>gb:AY128819808004743 (33)gb:AF275345_17825262e-94Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF009F22Sequence603004743 (33)gb:BT008775_16399714e-32Arabidopsis thaliana At4g24530 mRNA, complete cds.739004743 (33)gb:AF275345_1782526e-105Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF014K15Sequence526004743 (33)gb:AF275345_17825261e-79Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro770004743 (33)gb:AF275345_17825269e-80Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF018H04Sequence567004743 (33)gb:BT008775_16399713e-28Arabidopsis thaliana At4g24530 mRNA, complete cds.735004743 (33)gb:AF275345_17825266e-84Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF021D12Sequence571004743 (33)gb:BT008775_16399719e-27Arabidopsis thaliana At4g24530 mRNA, complete cds.688004743 (33)gb:AF275345_17825261e-90Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF031F14Sequence594004743 (33)gb:BT008775_16399711e-26Arabidopsis thaliana At4g24530 mRNA, complete cds.
JMFF035K07Sequence608004743 (33)gb:BT008775_16399711e-31Arabidopsis thaliana At4g24530 mRNA, complete cds.612004743 (33)gb:AF275345_17825261e-60Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF045E06Sequence634004743 (33)gb:AY093167_15751213e-44Arabidopsis thaliana unknown protein (At5g65470) mRNA, complete cds.>gb:AY128819649004743 (33)gb:AY093167_15751212e-96Arabidopsis thaliana unknown protein (At5g65470) mRNA, complete cds.>gb:AY128819
JMFF045L12Sequence673004743 (33)gb:AF275345_17825263e-97Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro581004743 (33)gb:AF275345_17825269e-49Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFN003D15Sequence612004743 (33)gb:AF275345_17825265e-53Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFN003N21Sequence401004743 (33)gb:BT008775_16399712e-13Arabidopsis thaliana At4g24530 mRNA, complete cds.
JMFN025B06Sequence474004743 (33)gb:AF275345_17825261e-33Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFN042O10Sequence537004743 (33)gb:AF275345_17825265e-41Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFN045P11Sequence630004743 (33)gb:AF275345_17825261e-73Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFS003C01Sequence567004743 (33)gb:AY093167_15751214e-43Arabidopsis thaliana unknown protein (At5g65470) mRNA, complete cds.>gb:AY128819
JMFS025G02Sequence626004743 (33)gb:BT008775_16399716e-35Arabidopsis thaliana At4g24530 mRNA, complete cds.
JMFS032D04Sequence486004743 (33)gb:BT008775_16399714e-25Arabidopsis thaliana At4g24530 mRNA, complete cds.
JMFS045G12Sequence619004743 (33)gb:AF275345_17825263e-90Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFS050F12Sequence595004743 (33)gb:BT008775_16399713e-28Arabidopsis thaliana At4g24530 mRNA, complete cds.
JMSF005M12Sequence324004743 (33)343004743 (33)gb:AF275345_17825265e-18Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMSF024A13Sequence673004743 (33)gb:AY093167_15751219e-41Arabidopsis thaliana unknown protein (At5g65470) mRNA, complete cds.>gb:AY128819754004743 (33)gb:AF275345_17825266e-95Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045L12- GGTAGTAATGAAATTATATTAAATATATAAATCTACAAAGCTCTCTATTCATGAAATA
JMFN042O10+ GGTAGTAATGAAATTATATTAAATATATAAATCTACAAAGCTCTCTATTCATGAAATA
JMFN003D15+ GGTAGTAATGAAATTATATTAAATATATAAATCTACAAAGCTCTCTATTCATGAAATA
rJMFF014K15- ATATATAAATCTACAAAGCTCTCTATTCATGAAATA
rJMFF018H04- TGAAATA
rJMFF035K07- AATA
JMFN025B06+ ATATAAATCTACAAAGCTCTCTATTCATGAAATA
rJMFF004C21- TTAAATATATAAATCTACAAAGCTCTCTATTCATGAAATA
                      ____________________________________________________________
consensus GGTAGTAATGAAATTATATTAAATATATAAATCTACAAAGCTCTCTATTCATGAAATA
 
. : . : . : . : . : . :
rJMFF045L12- GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
JMFN042O10+ GTTGTGTATATATGTCATGACAGCAATAAACATAAGCATGGTACACATCATCTTCCACCC
rJMSF005M12- ATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
JMFN003D15+ GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
rJMFF014K15- GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
rJMFF018H04- GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
rJMFF035K07- GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
JMFN025B06+ GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
rJMFF004C21- GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
rJMSF024A13- GCATGGTACACATCATCTTCCACCC
JMFN045P11+ CATCATCTTCCACCC
rJMFF006H14- AGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
                      ____________________________________________________________
consensus GTTGTGTATATATGTCATGACAGCAATAAACCTAAGCATGGTACACATCATCTTCCACCC
 
. : . : . : . : . : . :
rJMFF045L12- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
JMFN042O10+ CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMSF005M12- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
JMFN003D15+ CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMFF014K15- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMFF018H04- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMFF035K07- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
JMFN025B06+ CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMFF004C21- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMSF024A13- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGAGGGGGTGGCT
JMFN045P11+ CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMFF006H14- CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
rJMFF021D12- TGGCT
rJMFF009F22- ATGGGGGGGTGGCT
                      ____________________________________________________________
consensus CCAAAACTTAAATAATGAAGTGATATTCCTATATAGATGAACAAAGATGGGGGGGTGGCT
 
. : . : . : . : . : . :
rJMFF045L12- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
JMFN042O10+ TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMSF005M12- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
JMFN003D15+ TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF014K15- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF018H04- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF035K07- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
JMFN025B06+ TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF004C21- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMSF024A13- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
JMFN045P11+ TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF006H14- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF021D12- TTTTATTTCC-ACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
rJMFF009F22- TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
                      ____________________________________________________________
consensus TTTTATTTCCAACTAATACAATGCACAAACAATTGTTTCCAATCCCACATATATATAAAG
 
. : . : . : . : . : . :
rJMFF045L12- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
JMFN042O10+ AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMSF005M12- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
JMFN003D15+ AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF014K15- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF018H04- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF035K07- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
JMFN025B06+ AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF004C21- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMSF024A13- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
JMFN045P11+ AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF006H14- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF021D12- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
rJMFF009F22- AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
                      ____________________________________________________________
consensus AGTATCATAACCCCACACATCACCAGCTTCAAGCATTGCACATGCAATCAGGGGCAGGAT
 
. : . : . : . : . : . :
rJMFF045L12- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
JMFN042O10+ ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMSF005M12- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
JMFN003D15+ ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF014K15- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF018H04- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF035K07- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
JMFN025B06+ ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF004C21- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMSF024A13- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
JMFN045P11+ ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF006H14- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF021D12- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
rJMFF009F22- ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
JMFF045L12+ GGGTTTGCGGAGGCGGATCTCGCCTGGTCGGTTCGCGTGCC
                      ____________________________________________________________
consensus ATGTGTAGAGAGATTTAGCGGGTTTGCGGAGGCGGATCTCGCCTTGTCGGTTCGCGTGCC
 
. : . : . : . : . : . :
rJMFF045L12- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
JMFN042O10+ CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMSF005M12- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAA
JMFN003D15+ CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF014K15- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF018H04- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF035K07- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
JMFN025B06+ CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF004C21- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMSF024A13- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
JMFN045P11+ CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF006H14- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF021D12- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
rJMFF009F22- CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
JMFF045L12+ CTTCGATCACGGCGTCTNGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
                      ____________________________________________________________
consensus CTTCGATCACGGCGTCTTGGAACTCTGGCCACGTTAGATTTTTGTTCAGGAAGAGTTGGC
 
. : . : . : . : . : . :
rJMFF045L12- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
JMFN042O10+ CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
JMFN003D15+ CTAGAAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF014K15- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF018H04- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF035K07- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
JMFN025B06+ CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF004C21- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMSF024A13- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
JMFN045P11+ CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF006H14- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF021D12- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
rJMFF009F22- CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
JMFF014K15+ CTTCAAGTTATGGTACGTTCGATGTCCCACCA
JMFF045L12+ CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
                      ____________________________________________________________
consensus CTAGGAGTTGCATGTTGGGCCTTATGGTCTTCAAGTTATGGTACGTTCGATGTCCCACCA
 
. : . : . : . : . : . :
rJMFF045L12- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
JMFN042O10+ TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
JMFN003D15+ TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMFF014K15- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMFF018H04- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMFF035K07- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
JMFN025B06+ TTGCGTTGTGCATATTT-CCG
rJMFF004C21- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMSF024A13- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
JMFN045P11+ TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMFF006H14- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMFF021D12- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
rJMFF009F22- TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
JMFF014K15+ TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
JMFF045L12+ TTGCGTTGTGCATATTTGCGGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
                      ____________________________________________________________
consensus TTGCGTTGTGCATATTT-CCGGGTGATGCAGAAATGAAAATATCGCTGTGCATACCGACA
 
. : . : . : . : . : . :
rJMFF045L12- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTC
JMFN003D15+ TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF014K15- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF018H04- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF035K07- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF004C21- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMSF024A13- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
JMFN045P11+ TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF006H14- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF021D12- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
rJMFF009F22- TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
JMFF014K15+ TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
JMFF045L12+ TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
                      ____________________________________________________________
consensus TAGTAATCAACTGCAGCTAGTAAGGAAGCCTTTCCTTTAATTTCACCTCTTTCCTCTGAA
 
. : . : . : . : . : . :
JMFN003D15+ GAGGCGAGGCTCTTC
rJMFF014K15- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMFF018H04- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMFF035K07- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMFF004C21- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMSF024A13- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
JMFN045P11+ GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMFF006H14- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMFF021D12- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
rJMFF009F22- GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
JMFF014K15+ GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
JMFF045L12+ GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
                      ____________________________________________________________
consensus GAGGCGAGGCTCTTCTTGTTCTCCATCAGTGGAAACAATCGTCTCAAGGCTGATATCCGG
 
. : . : . : . : . : . :
rJMFF014K15- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
rJMFF018H04- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTCGTTGTCAAAGCC
rJMFF035K07- GCTGCGCCA
rJMFF004C21- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGCGGGGTGTTGTTGTCAAAGCC
rJMSF024A13- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
JMFN045P11+ GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
rJMFF006H14- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
rJMFF021D12- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
rJMFF009F22- GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
JMFF014K15+ GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
JMFF045L12+ GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
                      ____________________________________________________________
consensus GCTGCGCCACCGTAAACCTTGTGGGAAGCAAGATATAAGC-GGGTGTTGTTGTCAAAGCC
 
. : . : . : . : . : . :
rJMFF014K15- TAAAGCTGCCAGCAATAATCCAACTTTCTTCGGGGGGTCAGCGGGCACCGCCCCTGACTC
rJMFF018H04- TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
rJMFF004C21- TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
rJMSF024A13- TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
JMFN045P11+ TAAAGCTGCCAGCAATA
rJMFF006H14- TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
rJMFF021D12- TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
rJMFF009F22- TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
JMFF014K15+ TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
JMFF045L12+ TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
                      ____________________________________________________________
consensus TAAAGCTGCCAGCAATAATCCAAC-TTCTTC-GGGGGTCAGCGGGCACCGCCCCTGACTC
 
. : . : . : . : . : . :
rJMFF014K15- CTCAACTCCTCGTC
rJMFF018H04- CTCAACTCCTCG
rJMFF004C21- CTCAACTCCTCGTCG
rJMSF024A13- CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCAATATA-TCTGTC
rJMFF006H14- CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCCATATA-TCTGTC
rJMFF021D12- CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTTCCCCTGCCAATATA-TCTGTC
rJMFF009F22- CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCAATATA-TCTGTC
JMFF014K15+ CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCAATATA-TCTGTC
JMFF045L12+ CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCAATATA-TCTGTC
JMFS045G12+ TCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCAATATATTCTGTC
rJMFF045E06- TGTC
                      ____________________________________________________________
consensus CTCAACTCCTCGTCGGTGAATTGAGAGTTCAGCACTCTT-CCCTGCCAATATA-TCTGTC
 
. : . : . : . : . : . :
rJMSF024A13- GGTACTTTGCTA-GCG
rJMFF006H14- GGTACTTTGCTA-GCGAAGAGTTTCTCGGCCTTACCCCCACCGAAATCNCAAGCTG
rJMFF021D12- GGTACTTTGCTAGGCG-AGAGTTTCTCGGC
rJMFF009F22- GGTACTTTGCTA-GCG-AGAGTTTCTCGGCCTTACCCCCACCGAAATCACAAGCTGAATG
JMFF014K15+ GGTACTTTGCTA-GCG-AGAGTTTCTCGGCCTTACCCCCACCGAAATCACAAGCTGAATG
JMFF045L12+ GGTACTTTGCTA-GCG-AGAGTTTCTCGGCCTTACCCCCACCGAAATCACAAGCTGAATG
JMFS045G12+ GGTACTTTGCTA-GCG-AGAGTTTCTCGGCCTTACCCCCACCGAAATCACAAGCTGAATG
rJMFF045E06- GGTACTTTGCTA-GCG-AGAGTTTCTCGGCCTTACCCCCACCGAAATCACAAGCTGAATG
                      ____________________________________________________________
consensus GGTACTTTGCTA-GCG-AGAGTTTCTCGGCCTTACCCCCACCGAAATCACAAGCTGAATG
 
. : . : . : . : . : . :
rJMFF009F22- GGCANCCATATCC
JMFF014K15+ GGCAGCCATATCCTTATCAAAGCGGAGGTGAACCGCCACAAACTTCTGAGGCCCTTCGTC
JMFF045L12+ GGCAGCCATATCCTTATCAAAGCGGAGGTGAACCGCCACAAACTTCTGAGGCCCTTCGTC
JMFS045G12+ GGCAGCCATATCCTTATCAAAGCGGAGGTGAACCGCCACAAACTTCTGAGGCCCTTCGTC
rJMFF045E06- GGCAGCCATATCCTTATCAAAGCGGAGGTGAACCGCCACAAACTTCTGAGGCCCTTCGTC
                      ____________________________________________________________
consensus GGCAGCCATATCCTTATCAAAGCGGAGGTGAACCGCCACAAACTTCTGAGGCCCTTCGTC
 
. : . : . : . : . : . :
JMFF014K15+ TTTGCTAGCAGGATATCGGAGG
JMFF045L12+ TTTGCTAGCAGGATATCGGAGG
JMFS045G12+ TTTGCTAGCAGGATATCGGAGGCGATGAATAAGAGCATCTCCGAGGGCTCTGATATGCGG
rJMFF045E06- TTTGCTAGCAGGATATCGGAGGCGATGAATAAGAGCATCTCCGAGGGCTCTGATATGCGG
                      ____________________________________________________________
consensus TTTGCTAGCAGGATATCGGAGGCGATGAATAAGAGCATCTCCGAGGGCTCTGATATGCGG
 
. : . : . : . : . : . :
JMFS045G12+ TACGAAAACTAATGCTCGAAAGTTTACTTTGCAGCGTAGATGCTGGATATCCTTGGGCAT
rJMFF045E06- TACGAAAACTAATGCTCGAAAGTTTACTTTGCAGCGTAGATGCTGGATATCCTTGGGCAT
                      ____________________________________________________________
consensus TACGAAAACTAATGCTCGAAAGTTTACTTTGCAGCGTAGATGCTGGATATCCTTGGGCAT
 
. : . : . : . : . : . :
JMFS045G12+ GTTGTCAAATGCCAATCGGTGAGAAAACGGTGCAATTGCCGCGATTCCATAACTTCGAAG
rJMFF045E06- GTTGTCAAATGCCAATCGGTGAGAAAACGGTGCAATTGCCGCGATTCCATAACTTCGAAG
                      ____________________________________________________________
consensus GTTGTCAAATGCCAATCGGTGAGAAAACGGTGCAATTGCCGCGATTCCATAACTTCGAAG
 
. : . : . : . : . : . :
JMFS045G12+ GACGGGCAGCACGTTCTCCGAGTACCAGTTTGCAGAAGCATGAACCGGTGCTGTCTTGAT
rJMFF045E06- GACGGGCAGCACGTTCTCCGAGTACCAGTTTGCAGAAGCATGAACCGGTGCTGTCTTGAT
                      ____________________________________________________________
consensus GACGGGCAGCACGTTCTCCGAGTACCAGTTTGCAGAAGCATGAACCGGTGCTGTCTTGAT
 
. : . : . : . : . : . :
JMFS045G12+ TCTAGTCGGTCGAATAGCCGTAGAATAATACTCCCTCGTGCTCCACGAAAACTCATCAGG
rJMFF045E06- TCTAGTCGGTCGAATAGCCGTAGAATAATACTCCCTCGTGCTCCACGAAAACTCATCAGG
                      ____________________________________________________________
consensus TCTAGTCGGTCGAATAGCCGTAGAATAATACTCCCTCGTGCTCCACGAAAACTCATCAGG
 
. : . : . : . : . : . :
JMFS045G12+ CAACTCCTTTACTATAGAGATATCGTCTTTCAAAACCTCGATGAAATGATCGACATCAAA
rJMFF045E06- CAACTCCTTTACTATAGAGATATCGTCTTTCAAAACCTCGATGAAATGATCGACATCAAA
JMFF006H14+ ACCTCGATGAAATGATCGACATCAAA
JMFS003C01+ ATCGTCTTTCAAAACCTCGATGAAATGATCGACATCAAA
JMFF045E06+ TCCTNTACTATAGAGATATCGTCTTTCAAAACCTCGATGAAATGATCGACATCAAA
JMSF024A13+ CCTCGATGAAATGATCGACATCAAA
                      ____________________________________________________________
consensus CAACTCCTTTACTATAGAGATATCGTCTTTCAAAACCTCGATGAAATGATCGACATCAAA
 
. : . : . : . : . : . :
JMFS045G12+ GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
rJMFF045E06- GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFF006H14+ GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFS003C01+ GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFF045E06+ GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFF035K07+ GCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFF021D12+ ATCAC
JMFF018H04+ TCCAAATAAGGGATCAC
JMFF009F22+ CTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFS025G02+ CCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFS050F12+ CCAAATAAGGGATCAC
JMFF004C21+ CTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMSF024A13+ GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
JMFF031F14+ CAC
                      ____________________________________________________________
consensus GATATCCATGAAGGAGCTCGAATCTTGCCAAACTGGATTTACTTCCAAATAAGGGATCAC
 
. : . : . : . : . : . :
JMFS045G12+ GAGCGTAGCGTTCAGAATTTTCG
rJMFF045E06- GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF006H14+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFS003C01+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF045E06+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF035K07+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF021D12+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF018H04+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF009F22+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFS025G02+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFS050F12+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFS032D04+ TAGCGTTCAGAATTTTCGCAACCGCAAGTGCATCGCATATCCCCATTCTCTGTTG
JMFF004C21+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMSF024A13+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
JMFF031F14+ GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
                      ____________________________________________________________
consensus GAGCGTAGCGTTCAGAATTTTCGCAACCGCAACTGCATCGCATATCCCCATTCTCTGTTG
 
. : . : . : . : . : . :
rJMFF045E06- ATTNCATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTT
JMFF006H14+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFS003C01+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF045E06+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF035K07+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF021D12+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF018H04+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF009F22+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFS025G02+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFS050F12+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFS032D04+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFN003N21+ CATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF004C21+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMSF024A13+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
JMFF031F14+ ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
                      ____________________________________________________________
consensus ATTCAATCCTCCATCGAGGAACACCTGAAGATATCCCTCTGATTTTTCAGAGAACTTGGA
 
. : . : . : . : . : . :
JMFF006H14+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFS003C01+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF045E06+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF035K07+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF021D12+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF018H04+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF009F22+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFS025G02+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFS050F12+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFS032D04+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFN003N21+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF004C21+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMSF024A13+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
JMFF031F14+ GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
                      ____________________________________________________________
consensus GAAAAGACCCGAATCAGGAACGGGTTTCCATCCTTGGTTGGCCAAGGGCATCCATATTTC
 
. : . : . : . : . : . :
JMFF006H14+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFS003C01+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF045E06+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF035K07+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF021D12+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF018H04+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF009F22+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFS025G02+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFS050F12+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFS032D04+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFN003N21+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF004C21+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMSF024A13+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
JMFF031F14+ AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
                      ____________________________________________________________
consensus AGCTTTTTCTTCAGGGGTAGTTTCACGTTGCAGAGCACTTTTGAAAAGGCTCGAGTGCCT
 
. : . : . : . : . : . :
JMFF006H14+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFS003C01+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF045E06+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF035K07+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF021D12+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF018H04+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF009F22+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFS025G02+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFS050F12+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFS032D04+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFN003N21+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF004C21+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMSF024A13+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMFF031F14+ GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
JMSF005M12+ TGAAGCATAGATGAAAGTAGTGAA
                      ____________________________________________________________
consensus GGGTTTTGCGATAATCGATTCCGAGAGAATGGAAGGTGAAGCATAGATGAAAGTAGTGAA
 
. : . : . : . : . : . :
JMFF006H14+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFS003C01+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF045E06+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF035K07+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF021D12+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF018H04+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF009F22+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFS025G02+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFS050F12+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFS032D04+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFN003N21+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF004C21+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMSF024A13+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMFF031F14+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
JMSF005M12+ AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
                      ____________________________________________________________
consensus AAGGGTAGGAAAGAACGCTGGTAGAAGCAGCAGCAAAAGAGCAGCCATGGCTCCCCCTCT
 
. : . : . : . : . : . :
JMFF006H14+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFS003C01+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF045E06+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF035K07+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF021D12+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF018H04+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF009F22+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFS025G02+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFS050F12+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFS032D04+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFN003N21+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF004C21+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMSF024A13+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMFF031F14+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
JMSF005M12+ AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
                      ____________________________________________________________
consensus AGAGGTGAAGCCTCCATAAATCCACATGGTGGTCGGTGATGGTGGTCGGTGGTGGTGGTC
 
. : . : . : . : . : . :
JMFF006H14+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFS003C01+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGA
JMFF045E06+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFF035K07+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFF021D12+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFF018H04+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFF009F22+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFS025G02+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFS050F12+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFS032D04+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCT-AGATC
JMFN003N21+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCC
JMFF004C21+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMSF024A13+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMFF031F14+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
JMSF005M12+ GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
                      ____________________________________________________________
consensus GGCACTGGGTGGCGGTGGCGGTGGCGGTGGTGTTGAAGAGTTGAAAGAATCCCTGAGATC
 
. : . : . : . : . : . :
JMFF006H14+ TCAAAGGGACTTAAAAAG
JMFF045E06+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCT
JMFF035K07+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMFF021D12+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMFF018H04+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMFF009F22+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMFS025G02+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMFS050F12+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATNTAAGGATCTTTAAAGGGAAAGAA
JMFS032D04+ TCAAAGGGACTT
JMFF004C21+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCT
JMSF024A13+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMFF031F14+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
JMSF005M12+ TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
                      ____________________________________________________________
consensus TCAAAGGGACTTAAAAAGAATTATTGAGTGAGTAATCTAAGGATCTTTAAAGGGAAAGAA
 
. : . : . : . : . : . :
JMFF035K07+ GCAGCACATTTCATGGAGGAGGAGAGAGAG
JMFF021D12+ GCAGCACATTTCATGGAGGAGGAGAG
JMFF018H04+ GCAGCACATT
JMFF009F22+ GCAGCACATTTCATGGAGGAGGAGAG
JMFS025G02+ GCAGCACATTTCATGGAGGAGGAGAGAGAGA
JMFS050F12+ GCAGCACATTTCATGGAGGAGGAGAGAGAGAGAGAAGAA
JMSF024A13+ GCAGCACATTTCATGGAGGAGGAGAGAGAGAGAGAAGAAGGCAAAG
JMFF031F14+ GCAGCACATTTCATGGAGGAGGAGAGAGAGAGAGAAGAAGGCAAAG
JMSF005M12+ GCAGCACATTTCATGGAGGAGGAGAGAGAGAGAGAAGAAGGCAAAGCAAATACTGTGATC
                      ____________________________________________________________
consensus GCAGCACATTTCATGGAGGAGGAGAGAGAGAGAGAAGAAGGCAAAGCAAATACTGTGATC