Previous Contig 004740:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013M04Sequence593004740 (11)sp|O80796|IM30_ARATH5e-50Probable membrane-associated 30 kDa protein, chloroplast precursor.>pir|T02347|T
JMFF046L06Sequence456004740 (11)sp|O80796|IM30_ARATH2e-27Probable membrane-associated 30 kDa protein, chloroplast precursor.>pir|T02347|T404004740 (11)
JMSF004N14Sequence325004087 (25)gb:F15P11_16775653e-07Arabidopsis thaliana BAC F15P11.370004740 (11)sp|O80796|IM30_ARATH9e-07Probable membrane-associated 30 kDa protein, chloroplast precursor.>pir|T02347|T
JMSF004P16Sequence197004740 (11)326013193 (5)gb:AY584532_16162964e-05Lycopersicon esculentum DWARF1/DIMINUTO (DWF1) mRNA, complete cds.
JMSF005M06Sequence343004740 (11)
JMSF005M08Sequence233006526 (4)gb:AP005009_18472387e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P057508004740 (11)sp|O80796|IM30_ARATH6e-22Probable membrane-associated 30 kDa protein, chloroplast precursor.>pir|T02347|T
JMSF018M10Sequence487004740 (11)sp|O80796|IM30_ARATH1e-21Probable membrane-associated 30 kDa protein, chloroplast precursor.>pir|T02347|T778004740 (11)sp|Q8S0J7|IM30_ORYSA4e-66Probable membrane-associated 30 kDa protein, chloroplast precursor.>gb:AP003316_
JMSF037E02Sequence579004740 (11)sp|O80796|IM30_ARATH2e-37Probable membrane-associated 30 kDa protein, chloroplast precursor.>pir|T02347|T691004740 (11)sp|Q8S0J7|IM30_ORYSA1e-55Probable membrane-associated 30 kDa protein, chloroplast precursor.>gb:AP003316_

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046L06- AATACATAAAGTACATTATTCTAATTCATAAAAT
                      ____________________________________________________________
consensus AATACATAAAGTACATTATTCTAATTCATAAAAT
 
. : . : . : . : . : . :
rJMFF046L06- TCAACGATATCATTTTGGACAATAGTCCACACAGCTGAAATTTGCTGCCACAGCTTTTAG
                      ____________________________________________________________
consensus TCAACGATATCATTTTGGACAATAGTCCACACAGCTGAAATTTGCTGCCACAGCTTTTAG
 
. : . : . : . : . : . :
rJMFF046L06- GTTCAATCCCTCGTTATTCCATCACCTCATCAGATGTAAAAGCAAATGTAAGAACAGGGT
                      ____________________________________________________________
consensus GTTCAATCCCTCGTTATTCCATCACCTCATCAGATGTAAAAGCAAATGTAAGAACAGGGT
 
. : . : . : . : . : . :
rJMFF046L06- AAAACAAAACCTCACCAACACAGACAAGTTTGAATTATCTGATTCTAGTTGAAGGTGATC
rJMSF004N14- CTGATTCTAGTTG-AGGTGATC
                      ____________________________________________________________
consensus AAAACAAAACCTCACCAACACAGACAAGTTTGAATTATCTGATTCTAGTTGAAGGTGATC
 
. : . : . : . : . : . :
rJMFF046L06- CATTTCATTTACAAATTACAACACTACAATAACCCATAAGGACTTCCAGGCTGCACTTGT
rJMSF004N14- CATTTCATTTACAAATTACAACACTACAATAACCCATAAGGACTTCCAGGCTGCACTTGT
rJMSF037E02- TAACCCATAAGGACTTCCAGGCTGCACTTGT
rJMSF005M08- CATTTCATTTAC-AATNACAACACTACAATAACCCGNAAGGACTTCCAGGCTGCACTTGT
rJMSF018M10- CATTTCATTTACAAATTACAACACTACAATAACCCATAAGGACTTCCAGGCTGCACTTGT
                      ____________________________________________________________
consensus CATTTCATTTACAAATTACAACACTACAATAACCCATAAGGACTTCCAGGCTGCACTTGT
 
. : . : . : . : . : . :
rJMFF046L06- ATCCATATACAAAGTGAAAAAAAGAAACAATAAGATTATAATTTGACCATACGAGGCAGG
rJMSF004N14- ATCCATATACAAAGTGAAAAAAAGAAACAATAAGATTATAATTTGACCATACGAGGCAGG
rJMSF037E02- ATCCATATACAAAGTGAAAAAAAGAAACAATAAGATTATAATTTGACCATACGAGGCAGG
rJMSF005M08- ATCCATATACAAAGTGNAAAANAGAAACAATAAGATTATAATTTGACCATNCGAGGCAGG
rJMSF018M10- ATCCATATACAAAGTGAAAAAAAGAAACAATAAGATTATAATTTGACCATACGAGGCAGG
                      ____________________________________________________________
consensus ATCCATATACAAAGTGAAAAAAAGAAACAATAAGATTATAATTTGACCATACGAGGCAGG
 
. : . : . : . : . : . :
rJMFF046L06- ATCAACATTTTGTTTATGCTTTTGCCTCTTCATATGGCAATTCTTTGTTGCACATAAACT
rJMSF004N14- ATCAACATTTTGTTTATGCTTTTGCCTCTTCATATGGCAATTCTTTGTTGCACATAAACT
rJMSF037E02- ATCAACATTTTGTTTATGCTTTTGCCTCTTCATATGGCAATTCTTTGTTGCACATAAACT
rJMSF005M08- ATCAACATTTTGTTTATGCTTTTGCCTCTTCATATGGCAANTCTTTGTTGCACATAANCT
rJMSF018M10- ATCAACATTTTGTTTATGCTTTTGCCTCTTCATATGGCAATTCTTTGTTGCACATAAACT
                      ____________________________________________________________
consensus ATCAACATTTTGTTTATGCTTTTGCCTCTTCATATGGCAATTCTTTGTTGCACATAAACT
 
. : . : . : . : . : . :
rJMFF046L06- ATCTCTGGCA
rJMSF004N14- ATCTCTGGCAGTGTAAGAGTCTGAAAAATGATTCAAGATCACCCGTGATCCCTATAGATC
rJMSF037E02- ATCTCTGGCAGTGTAAGAGTCTGAAAAATGATTCAAGATCACCCGTGATCCCTATAGATC
rJMSF005M08- ATCTCTGGCAGTGTAAGAGTCTGAAAAATGATTCAAGATCACCCGTGATCCCTATAGATC
rJMSF018M10- ATCTCTGGCAGTGTAAGAGTCTGAAAAATGATTCAAGATCACCCGTGATCCCTATAGATC
                      ____________________________________________________________
consensus ATCTCTGGCAGTGTAAGAGTCTGAAAAATGATTCAAGATCACCCGTGATCCCTATAGATC
 
. : . : . : . : . : . :
rJMSF004N14- GTTGGCCCTCCTCCGTAATTCATTCAGTTCTTTCTCAATCTCTGCATCTTGAAACTGCAG
rJMSF037E02- GTTGGCCCTCCTCCGTAATTCATTCAGTTCTTTCTCAATCTCTGCATCTTGAAACTGCAG
rJMSF005M08- GTTGGCCCTCCTCCGTAATTCATTCAGTTCTTTCTCAATCTCTGCATCTTGAAACTGCAG
rJMSF018M10- GTTGGCCCTCCTCCGTAATTCATTCAGTTCTTTCTCAATCTCTGCATCTTGAAACTGCAG
                      ____________________________________________________________
consensus GTTGGCCCTCCTCCGTAATTCATTCAGTTCTTTCTCAATCTCTGCATCTTGAAACTGCAG
 
. : . : . : . : . : . :
rJMSF004N14- CGAGCCCGTTCTAGCAACGGGCGTTCTGCCCGGGGGAAGCTCACCTTTC
rJMSF037E02- CGAGCCCGTTCTAGCAACGGGCGTTCTGCCCGGTGGAAGCTCACCTTTCTTGGAGCTTCC
rJMSF005M08- CGAGCCCGTTCTAGCAACGGGCGTTCTGCCCGGTGGAAGCTCACCTTTCTTGGAGCTTCC
rJMSF018M10- CGAGCCCGTTCTAGCAACGGGCGTTCTGCCCGGTGGAAGCTCACCTTTCTTGGAGCTTCC
                      ____________________________________________________________
consensus CGAGCCCGTTCTAGCAACGGGCGTTCTGCCCGGTGGAAGCTCACCTTTCTTGGAGCTTCC
 
. : . : . : . : . : . :
rJMSF037E02- GGACAATTCTTTCTTTAGATCAGCAAGATCACTGTCAACAGAAGAGCTCTCCAACAATGC
rJMSF005M08- GGACAATTCTTTCTTTAGATCAGCAAGATCACTGTCAACAGAAGAGCTCTCCAACAATGC
rJMSF018M10- GGACAATTCTTTCTTTAGATCAGCAAGATCACTGTCAACAGAAGAGCTCTCCAACAATGC
                      ____________________________________________________________
consensus GGACAATTCTTTCTTTAGATCAGCAAGATCACTGTCAACAGAAGAGCTCTCCAACAATGC
 
. : . : . : . : . : . :
rJMSF037E02- AAACTTTCCTTCGAGCTCATCACTTGTTAGTTGGTTAAGAGCATCTGCTTGAGACTCCAT
rJMSF005M08- AAACTTTCCTTCGAGCTCATCACTTGTTAGTTGGTTAAGAGCATCTGCTTGAGACTCCAT
rJMSF018M10- AAACTTTCCTTCGAGCTCATCACTTGTTAGTTGGTTAAGAGCATCTGCTTGAGACTCCAT
                      ____________________________________________________________
consensus AAACTTTCCTTCGAGCTCATCACTTGTTAGTTGGTTAAGAGCATCTGCTTGAGACTCCAT
 
. : . : . : . : . : . :
rJMSF037E02- GGCCAGGACTTTTTCCTCCATTCTTTCAAAGGCTGAAAGGGCACTGCTTGTATTCACATT
rJMSF005M08- GGCCAGGACTTTTTCCTCCATTCTTTCAA
rJMSF018M10- GGCCAGGACTTTTTCCTCCATTCTTTCAAAGGCTGAAAGGGCACTGCTTGTATTCACATT
                      ____________________________________________________________
consensus GGCCAGGACTTTTTCCTCCATTCTTTCAAAGGCTGAAAGGGCACTGCTTGTATTCACATT
 
. : . : . : . : . : . :
rJMSF037E02- TCCCAGCATCTCAGATACTTTGGTTGCAGTCTTAGCAGACTGAGCACGTGCTTTTAATGT
rJMSF018M10- TCCCAGCATCTCAGATACTTTGGTTGCAGTCTTAGCAGACTGAGCACGTGCTTTTAATGT
                      ____________________________________________________________
consensus TCCCAGCATCTCAGATACTTTGGTTGCAGTCTTAGCAGACTGAGCACGTGCTTTTAATGT
 
. : . : . : . : . : . :
rJMSF037E02- ATCCTTTTTTGATTTTGCTTCCTGTCTCTTGCTCTCTAAAAGCCGTGTATTGCTGATCAG
rJMSF018M10- ATCCTTTTTTGATTTTGCTTCCTGTATCTTGCTCTCTAAAAGCCGTGTATTGCTGATCAG
                      ____________________________________________________________
consensus ATCCTTTTTTGATTTTGCTTCCTGTCTCTTGCTCTCTAAAAGCCGTGTATTGCTGATCAG
 
. : . : . : . : . : . :
rJMSF037E02- ATTCTCAACCACACCCTTCTGCTGATCAAGCTGAGCCTTCAATGCATTTGCATTATCAGC
rJMSF018M10- ATTCTCAACCACACCCTTCTGCTGATCAAGCTGAGCCTTCAATGCATTTGCATTATCAGC
JMFF013M04+ TTCAATGCATTTGCATTATCAGC
                      ____________________________________________________________
consensus ATTCTCAACCACACCCTTCTGCTGATCAAGCTGAGCCTTCAATGCATTTGCATTATCAGC
 
. : . : . : . : . : . :
rJMSF018M10- ATAAGATTTTCTACGTTTCAAAGCTTCACGTGCAAGATCCTCATCTCCCTTT
JMFF013M04+ ATAAGATTTTCTACGTTTCAGAGCTTCACGTGCAAGATCCTCATCTCCCTTTCCAAGAGC
JMSF037E02+ TTCCAAGAGC
                      ____________________________________________________________
consensus ATAAGATTTTCTACGTTTCAGAGCTTCACGTGCAAGATCCTCATCTCCCTTTCCAAGAGC
 
. : . : . : . : . : . :
JMFF046L06+ TATTTGTTTTC
JMFF013M04+ AAGCTGTGCTCTACGATACCAGTCCTCAGAAGCTTGTTGTGCAGCTTTGTATTTGTTTTC
JMSF037E02+ AAGCTGTGCTCTACGATACCAGTCCTCAGAAGCTTGTTGTGCAGCTTTGTATTTGTTTTC
                      ____________________________________________________________
consensus AAGCTGTGCTCTACGATACCAGTCCTCAGAAGCTTGTTGTGCAGCTTTGTATTTGTTTTC
 
. : . : . : . : . : . :
JMFF046L06+ CAACTGCTTCTGTGAAGCCAAGACCTGTGCTGTAGCTTGGCGCATTTTGATCAAATCATT
JMFF013M04+ CAACTGCTTCTGTGAAGCCAAGACCTGTGCTGTAGCTTGGCGCATTTTGATCAAATCATT
JMSF037E02+ CAACTGCTTCTGTGAAGCCAAGACCTGTGCTGTAGCTTGGCGCATTTTGATCAAATCATT
JMSF018M10+ ACCTGTGCTGTAGCTTGGCGCATTTTGATCAAATCATT
                      ____________________________________________________________
consensus CAACTGCTTCTGTGAAGCCAAGACCTGTGCTGTAGCTTGGCGCATTTTGATCAAATCATT
 
. : . : . : . : . : . :
JMFF046L06+ GTTCATTTCTAGCACAGTTTGCTCCAGGATCTTCTCTGGGTCTTCAAAGGAACTAATGAC
JMFF013M04+ GTTCATTTCTAGCACAGTTTGCTCCAGGATCTTCTCTGGGTCTTCAAAGGAACTAATGAC
JMSF037E02+ GTTCATTTCTAGCACAGTTTGCTCCAGGATCTTCTCTGGGTCTTCAAAGGAACTAATGAC
JMSF018M10+ GTTCATTTCTAGCACAGTTTGCTCCAGGATCTTCTCTGGGTCTTCAAAGGAACTAATGAC
                      ____________________________________________________________
consensus GTTCATTTCTAGCACAGTTTGCTCCAGGATCTTCTCTGGGTCTTCAAAGGAACTAATGAC
 
. : . : . : . : . : . :
JMFF046L06+ GGCATTAGCATAAGACTTGACTACTCTGGCAAATCTGTCAAAGAGATTACTGCGAACAAC
JMFF013M04+ GGCATTAGCATAAGACTTGACTACTCTGGCAAATCTGTCAAAGAGATTACTGCGAACAAC
JMSF037E02+ GGCATTAGCATAAGACTTGACTACTCTGGCAAATCTGTCAAAGAGATTACTGCGAACAAC
JMSF018M10+ GGCATTAGCATAAGACTTGACTACTCTGGCAAATCTGTCAAAGAGATTACTGCGAACAAC
                      ____________________________________________________________
consensus GGCATTAGCATAAGACTTGACTACTCTGGCAAATCTGTCAAAGAGATTACTGCGAACAAC
 
. : . : . : . : . : . :
JMFF046L06+ AAGGGCACCAGAGGTGAATCTGTTGGAATGAGGACGCTGTCCAACTGCAACTGCAAGTTT
JMFF013M04+ AAGGGCACCAGAGGTGAATCTGTTGGAATGAGGACGCTGTCCAACTGCAACTGCAAGTTT
JMSF037E02+ AAGGGCACCAGAGGTGAATCTGTTGGAATGAGGACGCTGTCCAACTGCAACTGCAAGTTT
JMSF018M10+ AAGGGCACCAGAGGTGAATCTGTTGGAATGAGGACGCTGTCCAACTGCAACTGCAAGTTT
JMSF005M06+ ATCTGTTGGAATGAGGACGCTGTCCAACTGCAACTGCAAGTTT
                      ____________________________________________________________
consensus AAGGGCACCAGAGGTGAATCTGTTGGAATGAGGACGCTGTCCAACTGCAACTGCAAGTTT
 
. : . : . : . : . : . :
JMFF046L06+ TAAAGCTCCAGCTCTACGACCAAAAAAGGAAGTTCCCAAAGAAGATGGCTTCACAACCAC
JMFF013M04+ TAAAGCTCCAGCTCTACGACCAAAAAAGGAAGTTCCCAAAGAAGATGGCTTCACAACCAC
JMSF037E02+ TAAAGCTCCAGCTCTACGACCAAAAAAGGAAGTTCCCAAAGAAGATGGCTTCACAACCAC
JMSF018M10+ TAAAGCTCCAGCTCTACGACCAAAAAAGGAAGTTCCCAAAGAAGATGGCTTCACAACCAC
JMSF005M06+ TAAAGCTCCAGCTCTACGACCAAAAAAGGAAGTTCCCAAAGAAGATGGCTTCACAACCAC
                      ____________________________________________________________
consensus TAAAGCTCCAGCTCTACGACCAAAAAAGGAAGTTCCCAAAGAAGATGGCTTCACAACCAC
 
. : . : . : . : . : . :
JMFF046L06+ TATCCCCTTATTGTTACATGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
JMFF013M04+ TATCCCCTTATTGTTACATGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
JMSF037E02+ TATCCCCTTATTGTTACANGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
JMSF018M10+ TATCCCCTTATTGTTACANGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
JMSF004P16+ TTGTTACANGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
JMSF005M06+ TATCCCCTTATTGTTACANGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
                      ____________________________________________________________
consensus TATCCCCTTATTGTTACATGACGGAGCGGAAAGAGTTGAAGCTGTGCTCATTCCTGCTAT
 
. : . : . : . : . : . :
JMFF046L06+ GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
JMFF013M04+ GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
JMSF037E02+ GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
JMSF018M10+ GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
JMSF004P16+ GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
JMSF005M06+ GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
                      ____________________________________________________________
consensus GGGTGCTCTTAGAGCCATTTTCTTCTCGGTTAACGAAGCAAAGATTCCGTCTTTGGGCGG
 
. : . : . : . : . : . :
JMFF046L06+ GACCGTGTAGGCGTTTGGAGAGAGA
JMFF013M04+ GACCGTGTAGGCGTTTGGAGAGAGAGAGAG
JMSF037E02+ GACCGTGTAGGCGTTTGGAGAGAGAGAGAGAGAGAGAGGAGAAGTCGGGAAATCAATATG
JMSF018M10+ GACCGTGTAGGCGTTTGGAGAGAGAGAGAGAGAGAGAGGAGAAGTCGGGAAATCAATATG
JMSF004P16+ GACCGTGTAGGCGTTTGGAGAGAGAGAGAGAGAGAGAGGAGAAGTCGGGAAATCAATATG
JMSF005M06+ GACCGTGTAGGCGTTTGGAGAGAGAGAGAGAGAGAGAGGAGAAGTCGGGAAATCAATATG
                      ____________________________________________________________
consensus GACCGTGTAGGCGTTTGGAGAGAGAGAGAGAGAGAGAGGAGAAGTCGGGAAATCAATATG
 
. : . : . : . : . : . :
JMSF037E02+ TACTCTGCAAATCCAAAGAAGGGGTCC
JMSF018M10+ TACTCTGCAAATCCAAAGAAGGGGTCC
JMSF004P16+ TACTCTGCAAATCCAAAGAAGGGGTCC
JMSF005M06+ TACTCTGCAAATCCAAAGAAGGGGTCCTGGAGAGGAGAGAGACTGTGCTCTTTTTTTCTC
                      ____________________________________________________________
consensus TACTCTGCAAATCCAAAGAAGGGGTCCTGGAGAGGAGAGAGACTGTGCTCTTTTTTTCTC