Previous Contig 004738:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004J02Sequence536004738 (4)gb:BT000960_16352157e-18Arabidopsis thaliana clone C105219 unknown protein (At1g10660) mRNA, complete cd678008333 (2)gb:BT000960_16352156e-40Arabidopsis thaliana clone C105219 unknown protein (At1g10660) mRNA, complete cd
JMSF005L22Sequence333004738 (4)421008333 (2)gb:BT000960_16352157e-23Arabidopsis thaliana clone C105219 unknown protein (At1g10660) mRNA, complete cd
JMSF006B07Sequence227004738 (4)
JMSF006P09Sequence166002174 (10)214004738 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004J02+ TCCTGTAAGTAAGTAGACANACAGGATGGATGGATTTGTGACATGTGTTCCAAACTT
                      ____________________________________________________________
consensus TCCTGTAAGTAAGTAGACANACAGGATGGATGGATTTGTGACATGTGTTCCAAACTT
 
. : . : . : . : . : . :
JMFF004J02+ CATCCTTGTGCAAAGTCCCTATTTTTTCTTGCAAATCCTCCCTCTGCTGATTTCTTGATT
                      ____________________________________________________________
consensus CATCCTTGTGCAAAGTCCCTATTTTTTCTTGCAAATCCTCCCTCTGCTGATTTCTTGATT
 
. : . : . : . : . : . :
rJMSF006P09+ GCTGCAAACACCN
JMFF004J02+ TTGGTGAGCCTTCATACCTCCAAACTATCAGCGCAGAAACCACCATAGCTGCAAACACCC
                      ____________________________________________________________
consensus TTGGTGAGCCTTCATACCTCCAAACTATCAGCGCAGAAACCACCATAGCTGCAAACACCC
 
. : . : . : . : . : . :
rJMSF006P09+ ATATGGCACAGNCTAGGACTCTCCAGTTCAACCAGTANCTTGGAGTATTCGTGTNTGATG
JMFF004J02+ ATATGGCACAGACTAGGAATCTCCAGTTCAACCAGTAACTTGGAGTATTTGTGTCTGATG
                      ____________________________________________________________
consensus ATATGGCACAGACTAGGACTCTCCAGTTCAACCAGTAACTTGGAGTATTTGTGTCTGATG
 
. : . : . : . : . : . :
JMSF006B07+ CCACTTGATTCATGCAATCTTGGGGAAT
rJMSF006P09+ TCATGATTGGCCTCCAGGTGTGGTTC
JMFF004J02+ TCATGATTGGCCACCAGGTGTGGTTCGAGAACCCACTTGATTCATGCAATCTTGGGGAAT
JMSF005L22+ CCACTTGATTCATGCAATCTTGGGGAAT
                      ____________________________________________________________
consensus TCATGATTGGCCTCCAGGTGTGGTTCGAGAACCCACTTGATTCATGCAATCTTGGGGAAT
 
. : . : . : . : . : . :
JMSF006B07+ CAGTACATCATTACCCTTTCTCTGTGAAATATGATTGTGATGAAGAATGAAAAACCCAGA
JMFF004J02+ CAGTACATCATTACCCTTTCTCTGTGAAATATGATTGTGATGAAGAATGAAAAACCCAGA
JMSF005L22+ CAGTACATCATTACCCTTTCTCTGTGAAATATGATTGTGATGAAGAATGAAAAACCCAGA
                      ____________________________________________________________
consensus CAGTACATCATTACCCTTTCTCTGTGAAATATGATTGTGATGAAGAATGAAAAACCCAGA
 
. : . : . : . : . : . :
JMSF006B07+ AAGGGAAACGCGGCGGGAAATGGGAATATGCTATAATGCTAATTGATCC
JMFF004J02+ AAGGGAAACGCGGCGGGAAATGGGAATATGCTATAATGCTAATTGATCCTCAACGACAAC
JMSF005L22+ AAGGGAAACGCGGCGGGAAATGGGAATATGCTATAATGCTAATTGATCCTCAACGACAAC
                      ____________________________________________________________
consensus AAGGGAAACGCGGCGGGAAATGGGAATATGCTATAATGCTAATTGATCCTCAACGACAAC
 
. : . : . : . : . : . :
JMFF004J02+ CATCCGATGCTGAATTTGCGGTTTAGTTTGGAGTTCCGTTCAATCGATGGGTCCACGGAT
JMSF005L22+ TATCCGATGCTGAATTTGCGGTTTAGTTTGGAGTTCCGTTCAATCGATGGGTCCACGGAT
                      ____________________________________________________________
consensus TATCCGATGCTGAATTTGCGGTTTAGTTTGGAGTTCCGTTCAATCGATGGGTCCACGGAT
 
. : . : . : . : . : . :
JMFF004J02+ GCAGTGGGAGAGAGAGAGAGAGAGATGTTGAAGAAAGAAGAGAGCGGCAGAAAGAAAGT
JMSF005L22+ GCAGTGGGAGAGAGAGAGAGAGAGATGTTGAAGAAAGAAGAGAGCGGCAGAAAGAAAGTA
                      ____________________________________________________________
consensus GCAGTGGGAGAGAGAGAGAGAGAGATGTTGAAGAAAGAAGAGAGCGGCAGAAAGAAAGTA