Previous Contig 004736:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004H15Sequence548004736 (17)gb:ATAC016829_15436342e-18Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc757008644 (20)gb:ATAC016829_15436343e-56Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF008J11Sequence550004736 (17)gb:ATAC016829_15436342e-18Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc749008644 (20)gb:ATAC016829_15436342e-55Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF010E10Sequence626004736 (17)gb:ATAC016829_15436347e-23Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc723008644 (20)gb:ATAC016829_15436343e-49Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF010F13Sequence560004736 (17)gb:ATAC016829_15436342e-18Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc633008644 (20)gb:ATAC016829_15436341e-32Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF017O13Sequence552004736 (17)gb:ATAC016829_15436342e-18Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc690008644 (20)gb:ATAC016829_15436342e-59Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF023F13Sequence419004736 (17)gb:AY087168_15722021e-05Arabidopsis thaliana clone 32414 mRNA, complete sequence.629008644 (20)gb:ATAC016829_15436345e-37Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF025A11Sequence575004736 (17)gb:ATAC016829_15436342e-18Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc801008644 (20)gb:ATAC016829_15436345e-79Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF046F08Sequence456004736 (17)gb:AY087168_15722023e-07Arabidopsis thaliana clone 32414 mRNA, complete sequence.409008644 (20)gb:ATAC016829_15436342e-21Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF005L15Sequence332004736 (17)gb:AY548484_23600110.027Frog virus 3, complete genome.376008644 (20)gb:AY087168_15722021e-04Arabidopsis thaliana clone 32414 mRNA, complete sequence.
JMSF006L23Sequence334004736 (17)gb:AY548484_23600110.027Frog virus 3, complete genome.114008644 (20)
JMSF010G07Sequence381004736 (17)gb:AY548484_23600110.003Frog virus 3, complete genome.765008644 (20)gb:ATAC016829_15436341e-56Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF015O12Sequence457004736 (17)gb:AY087168_15722023e-07Arabidopsis thaliana clone 32414 mRNA, complete sequence.784008644 (20)gb:ATAC016829_15436341e-60Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF020C16Sequence705004736 (17)gb:ATAC016829_15436341e-31Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc662008644 (20)gb:ATAC016829_15436344e-37Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF026O11Sequence676004736 (17)gb:ATAC016829_15436346e-29Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc685008644 (20)gb:ATAC016829_15436343e-46Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF031A12Sequence677004736 (17)gb:ATAC016829_15436341e-28Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc742008644 (20)gb:ATAC016829_15436345e-54Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF039G24Sequence667004736 (17)gb:ATAC016829_15436344e-28Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc805008644 (20)gb:ATAC016829_15436342e-59Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMSF049E02Sequence565004736 (17)gb:ATAC016829_15436342e-18Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc622008644 (20)gb:ATAC016829_15436341e-55Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031A12+ TGGTGCATTTGGCAGCCAAA
JMSF026O11+ TGGTGCATTGGGCAGCCAAA
JMSF039G24+ GGCAGCCAAA
JMSF020C16+ CTAAGAACCCCACAGGTTNGTAACCATNTGGTGCATTTGGCAGCCAAA
                      ____________________________________________________________
consensus CTAAGAACCCCACAGGTTNGTAACCATNTGGTGCATTTGGCAGCCAAA
 
. : . : . : . : . : . :
JMSF031A12+ CGTAACCAGACCCGTTACAACCACCATCCATAGTCCATACTAAAGTATAGCTAAGAGGTT
JMSF026O11+ CGTAACCAGACCCGTTACAACCACCATCCATAGTCCATACTAAAGTATAGCTAAGAGGTT
JMSF039G24+ CGTAACCAGACCCGTTACAACCACCATCCATAGTCCATACTAAAGTATAGCTAAGAGGTT
JMFF010E10+ ATAGTCCATACTAAAGTATAGCTAAGAGGTT
JMSF020C16+ CGTAACCAGACCCGTTACAACCACCATCCATAGTCCATACTAAAGTATAGCTAAGAGGTT
                      ____________________________________________________________
consensus CGTAACCAGACCCGTTACAACCACCATCCATAGTCCATACTAAAGTATAGCTAAGAGGTT
 
. : . : . : . : . : . :
JMSF031A12+ TCTCTAGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMSF026O11+ TCTCTAGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMSF039G24+ TCTCTAGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMFF025A11+ CCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMFF004H15+ AGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMFF010E10+ TCTCTAGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMFF017O13+ TTGTCCCCCGAGCTGCCCA
JMFF008J11+ CCCCCGAGCTGCCCA
JMSF020C16+ TCTCTAGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
JMSF049E02+ ACACAGTTGTCCCCCGAGCTGCCCA
JMFF010F13+ AGTTGTCCCCCGAGCTGCCCA
                      ____________________________________________________________
consensus TCTCTAGAGCGGGAAGGTCCGATCCAGAGTCTTGAACACAGTTGTCCCCCGAGCTGCCCA
 
. : . : . : . : . : . :
JMSF031A12+ AATCTCGGGCAGCAGGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMSF026O11+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMSF039G24+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMFF025A11+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMFF004H15+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMFF010E10+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMFF017O13+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMFF008J11+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMSF020C16+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMSF049E02+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
JMFF010F13+ AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
                      ____________________________________________________________
consensus AATCTCGGGCAGCAAGAACATAGCCGCTCAACTGCTTGTCATCGAGCTGACAGTAGTGAC
 
. : . : . : . : . : . :
JMSF031A12+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMSF026O11+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMSF039G24+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF025A11+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF004H15+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF010E10+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF017O13+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF023F13+ GATT
JMFF008J11+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF046F08+ GGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMSF020C16+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMSF049E02+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMFF010F13+ CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
JMSF015O12+ ACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
                      ____________________________________________________________
consensus CAAGAACAGAAAACCCTTCGGGGACATCAACCGGCTGATAAAATGTTACGCTTTTTGATT
 
. : . : . : . : . : . :
JMSF031A12+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMSF026O11+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTAAACCA
JMSF039G24+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF025A11+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF004H15+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF010E10+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF017O13+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF023F13+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF008J11+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF046F08+ NTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMSF020C16+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMSF049E02+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMFF010F13+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMSF015O12+ TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
JMSF010G07+ CGAACTGACTGATCTGAACCA
                      ____________________________________________________________
consensus TTGATTTTCCAAACAATGGCTTGCAACTCCATATTTTTTCGAACTGACTGATCTGAACCA
 
. : . : . : . : . : . :
JMSF031A12+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF026O11+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF039G24+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF025A11+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF004H15+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF010E10+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF017O13+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF023F13+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF008J11+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF046F08+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF020C16+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF006L23+ CTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF049E02+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMFF010F13+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF015O12+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF010G07+ CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
JMSF005L15+ CGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
                      ____________________________________________________________
consensus CTTCAATCTCCCCTAGGCGTATTCTTCCCGTGGCAAAACCATTCCCTTGAGGCCAGTGGG
 
. : . : . : . : . : . :
JMSF031A12+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF026O11+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF039G24+ GGAGGGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF025A11+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF004H15+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF010E10+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF017O13+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF023F13+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF008J11+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF046F08+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF020C16+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF006L23+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF049E02+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMFF010F13+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF015O12+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF010G07+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
JMSF005L15+ GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
                      ____________________________________________________________
consensus GGAGAGGTGAAGGGAGAGAAAAGGGGTGGGGTTTCTCCCCTGGAAACAAGTCATAGCCAC
 
. : . : . : . : . : . :
JMSF031A12+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF026O11+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF039G24+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF025A11+ TCTGTTTGTCCC--CACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF004H15+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF010E10+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF017O13+ TCTGTTTGTCCC--CACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF023F13+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF008J11+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF046F08+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF020C16+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF006L23+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF049E02+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMFF010F13+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF015O12+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF010G07+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
JMSF005L15+ TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
                      ____________________________________________________________
consensus TCTGTTTGTCCCAGCACCAGCAACAATCCATCCAAACACTTCTCCTCTCTTCTCCTTTAT
 
. : . : . : . : . : . :
JMSF031A12+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF026O11+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF039G24+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF025A11+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF004H15+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF010E10+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF017O13+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF023F13+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF008J11+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF046F08+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF020C16+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF006L23+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF049E02+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMFF010F13+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF015O12+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF010G07+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
JMSF005L15+ GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
                      ____________________________________________________________
consensus GATCAAGGCAGCACCTTTTTGCAATTTCTCCAAAAACCCACCACCAAACTTCTCCTCCCA
 
. : . : . : . : . : . :
JMSF031A12+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF026O11+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF039G24+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF025A11+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF004H15+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF010E10+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF017O13+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF023F13+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF008J11+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF046F08+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF020C16+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF006L23+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF049E02+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMFF010F13+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF015O12+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF010G07+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
JMSF005L15+ GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
                      ____________________________________________________________
consensus GAAATGGGAATTGTGAATTTGTGTGTGTTTGGTGGTTCGGGTGGGGGGAAGCGGTGGTTA
 
. : . : . : . : . : . :
JMSF031A12+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATC
JMSF026O11+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCA
JMSF039G24+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTC
JMFF025A11+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCAT
JMFF004H15+ GAGAGAAGCACA
JMFF010E10+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCAT
JMFF017O13+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCAT
JMFF023F13+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCAT
JMFF008J11+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCAT
JMFF046F08+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATC
JMSF020C16+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATC
JMSF006L23+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATC
JMSF049E02+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATAGG
JMFF010F13+ GAGGGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATAGGC
JMSF015O12+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATAGGC
JMSF010G07+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATAGGC
JMSF005L15+ GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATAGGCC
                      ____________________________________________________________
consensus GAGAGAAGCACAGCCCTATTCCCTTCTCTCTCTCCTACTTTTTCTAATTCCTCATAGGCC