Previous Contig 004734:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001H09Sequence488004734 (4)gb:AY091770_15747305e-32Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi
JMSF005L11Sequence337004734 (4)gb:AY091770_15747306e-11Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi
JMSF025B09Sequence706004734 (4)gb:AY091770_15747304e-43Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi725012388 (3)gb:AY091770_15747301e-29Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi
JMSF027H11Sequence602004734 (4)gb:AY091770_15747304e-20Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi779012388 (3)gb:AY091770_15747301e-31Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025B09+ TGAGAGTCCATAGATGGTCTAGCCTCAAGAGACTCTGCTTCCTTCAC
                      ____________________________________________________________
consensus TGAGAGTCCATAGATGGTCTAGCCTCAAGAGACTCTGCTTCCTTCAC
 
. : . : . : . : . : . :
JMSF025B09+ TTTGGTCTGAGAGTCCATAGATGGTCCAGGCACAACCGCCTCTGCTTCTATTTCTGATGA
                      ____________________________________________________________
consensus TTTGGTCTGAGAGTCCATAGATGGTCCAGGCACAACCGCCTCTGCTTCTATTTCTGATGA
 
. : . : . : . : . : . :
JMSF025B09+ AGGTGGTGGTGGAACATTTTCCCTCGATGAACTGCCCTGCTCAGGTGAGGCAGAATTCAA
                      ____________________________________________________________
consensus AGGTGGTGGTGGAACATTTTCCCTCGATGAACTGCCCTGCTCAGGTGAGGCAGAATTCAA
 
. : . : . : . : . : . :
JMSF025B09+ AGTTCCAGGAGATGATTCAGCCTTAGAGGCAAGTGCAGCAGTCAACAGTGTCTCCTGAAT
                      ____________________________________________________________
consensus AGTTCCAGGAGATGATTCAGCCTTAGAGGCAAGTGCAGCAGTCAACAGTGTCTCCTGAAT
 
. : . : . : . : . : . :
JMSF025B09+ ATGAAGACTTAGCCATGCCTTTTCTAAGCTGGATGCTAGAACGTCTGCAGCAACAAAGCC
                      ____________________________________________________________
consensus ATGAAGACTTAGCCATGCCTTTTCTAAGCTGGATGCTAGAACGTCTGCAGCAACAAAGCC
 
. : . : . : . : . : . :
JMSF025B09+ CTCATGTTGCCATAGTTGTACGCCATTGTATCCAATAGCAGTTATACATGGGGCAGCTTT
                      ____________________________________________________________
consensus CTCATGTTGCCATAGTTGTACGCCATTGTATCCAATAGCAGTTATACATGGGGCAGCTTT
 
. : . : . : . : . : . :
JMSF025B09+ CTGTGGATACAATGCTGAGAAATTTATTGCATCACTACTTCCTTCCACAATGTGCAACAA
JMSF001H09+ ACAATGCTGAGAAATTTATTGCATCACTACTTCCTTCCACAATGTGCAACAA
JMSF027H11+ ACAATGCTGAGAAATTTATTGCATCACTACTTCCTTCCACAATGTGCAACAA
                      ____________________________________________________________
consensus CTGTGGATACAATGCTGAGAAATTTATTGCATCACTACTTCCTTCCACAATGTGCAACAA
 
. : . : . : . : . : . :
JMSF025B09+ AATGCAATACTTAGATAAAGACCCTGCCACTTGTGAGTCCAACCATGTAGAGGTTTCCAA
JMSF001H09+ AATGCAATACTTAGATAAAGACCCTGCCACTTGTGAGTCCAACCATGTAGAGGTTTCCAA
JMSF027H11+ AATGCAATACTTAGATAAAGACCCTGCCACTTGTGAGTCCAACCATGTAGAGGTTTCCAA
JMSF005L11+ TAAAGACCCTGCCACTTGTGAGTCCAACCATGTAGAGGTTTCCAA
                      ____________________________________________________________
consensus AATGCAATACTTAGATAAAGACCCTGCCACTTGTGAGTCCAACCATGTAGAGGTTTCCAA
 
. : . : . : . : . : . :
JMSF025B09+ ATTATTAGATTCTGAGTTATCACCTGAGATGTAAACTACAAAAAGTTTCTTCTGCTGTTT
JMSF001H09+ ATTATTAGATTCTGAGTTATCACCTGAGATGTAAACTACAAAAAGTTTCTTCTGCTGTTT
JMSF027H11+ ATTATTAGATTCTGAGTTATCACCTGAGATGTAAACTACAAAAAGTTTCTTCTGCTGTTT
JMSF005L11+ ATTATTAGATTCTGAGTTATCACCTGAGATGTAAACTACAAAAAGTTTCTTCTGCTGTTT
                      ____________________________________________________________
consensus ATTATTAGATTCTGAGTTATCACCTGAGATGTAAACTACAAAAAGTTTCTTCTGCTGTTT
 
. : . : . : . : . : . :
JMSF025B09+ GGCTTCAGTAATTGCTTCACCAATAGACCCCTTGAATGCAAGAGATGACAGAGACTGCTC
JMSF001H09+ GGCTTCAGTAATTGCTTCACCAATAGACCCCTTGAATGCAAGAGATGACAGAGACTGCTC
JMSF027H11+ GGCTTCAGTAATTGCTTCACCAATAGACCCCTTGAATGCAAGAGATGACAGAGACTGCTC
JMSF005L11+ GGCTTCAGTAATTGCTTCACCAATAGACCCCTTGAATGCAAGAGATGACAGAGACTGCTC
                      ____________________________________________________________
consensus GGCTTCAGTAATTGCTTCACCAATAGACCCCTTGAATGCAAGAGATGACAGAGACTGCTC
 
. : . : . : . : . : . :
JMSF025B09+ CATCTAAATCAGGTATGTAACAACAATACCTCTAATTGTAGTCAACAGCCCTCTTTACCT
JMSF001H09+ CATCTAAATCAGGTATGTAACAACAATACCTCTAATTGTAGTCAACAGCCCTCTTTACCT
JMSF027H11+ CATCTAAATCAGGTATGTAACAACAATACCTCTAATTGTAGTCAACAGCCCTCTTTACCT
JMSF005L11+ CATCTAAATCAGGTATGTAACAACAATACCTCTAATTGTAGTCAACAGC--------CCT
                      ____________________________________________________________
consensus CATCTAAATCAGGTATGTAACAACAATACCTCTAATTGTAGTCAACAGCCCTCTTTACCT
 
. : . : . : . : . : . :
JMSF025B09+ ATTCCTCCTCCTCGGAGTGGGTTTCCGTCTCTGATGTCTCTCAGCTTCCTTCCAGTTC
JMSF001H09+ ATTCCTCCTCCTCGGAGTGGGTTTCCGTCTCTGATGTCTCTCAGCTTCCTTCCAGTTCGA
JMSF027H11+ ATTCCTCCTCCTCGGAGTGGGTTTCCGTCTCTGATGTCTCTCAGCTTCCTTCCAGTTCGA
JMSF005L11+ ATTCCTCCTCCTCGGAGTGGGTTTCCGTCTCTGATGTCTCTCAGCTTCCTTCCAGTTCGA
                      ____________________________________________________________
consensus ATTCCTCCTCCTCGGAGTGGGTTTCCGTCTCTGATGTCTCTCAGCTTCCTTCCAGTTCGA
 
. : . : . : . : . : . :
JMSF001H09+ GACGACACCTAT
JMSF027H11+ GACGACACCTAT
JMSF005L11+ GACGACACCTATTCGTTTTCCCCTTTTTCCTCACTAGGCGGTTTTGGCCTGTTGGTGTCC
                      ____________________________________________________________
consensus GACGACACCTATTCGTTTTCCCCTTTTTCCTCACTAGGCGGTTTTGGCCTGTTGGTGTCC