Previous Contig 004730:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011I09Sequence550004730 (5)pir|T47861|T478617e-79nucleolar autoantigen-like protein - Arabidopsis thaliana>gb:ATT8B10_1556455 Ara715008716 (4)
JMFF031O20Sequence560004730 (5)pir|T47861|T478614e-76nucleolar autoantigen-like protein - Arabidopsis thaliana>gb:ATT8B10_1556455 Ara714008716 (4)
JMFF034H19Sequence549004730 (5)pir|T47861|T478615e-74nucleolar autoantigen-like protein - Arabidopsis thaliana>gb:ATT8B10_1556455 Ara691008716 (4)
JMFF040I22Sequence552004730 (5)pir|T47861|T478614e-74nucleolar autoantigen-like protein - Arabidopsis thaliana>gb:ATT8B10_1556455 Ara719008716 (4)
JMSF005K24Sequence360004730 (5)pir|T47861|T478612e-40nucleolar autoantigen-like protein - Arabidopsis thaliana>gb:ATT8B10_1556455 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040I22+ CAAGTGTACAATC
JMFF034H19+ GTGTACAATC
JMFF011I09+ GTGTACAATC
                      ____________________________________________________________
consensus CAAGTGTACAATC
 
. : . : . : . : . : . :
JMFF040I22+ AGGCCTCCGAAATGTTGAGAGAGCAGCTAAGGCTGCAATGTTGGCAGCATCAACAAGATT
JMFF034H19+ AGGCCTCCGAAATGTTGAGAGAGCAGCTAAGGCTGCAATGTTGGCAGCATCAACAAGATT
JMFF031O20+ CGAAATGTTGAGAGAGCAGCTAAGGCTGCAATGTTGGCAGCATCAACAAGATT
JMFF011I09+ AGGCCTCCGAAATGTTGAGAGAGCAGNTAAGGCTGCAATGTTGGCAGCATCAACAAGATT
                      ____________________________________________________________
consensus AGGCCTCCGAAATGTTGAGAGAGCAGCTAAGGCTGCAATGTTGGCAGCATCAACAAGATT
 
. : . : . : . : . : . :
JMFF040I22+ CCCTCCATTGTCTAAAATTTGGAGATCAATACGGATAGACCAAACCCACTTCCCAGCTAC
JMFF034H19+ CCCTCCATTGTCTAAAATTTGGAGATCAATACGGATAGACCAAACCCACTTCCCAGCTAC
JMFF031O20+ CCCTCCATTGTCTAAAATTTGGAGATCAATACGGATAGACCAAACCCACTTCCCAGCTAC
JMFF011I09+ CCCTCCATTGTCTAAAATTTGGAGATCAATACGGATAGACCAAACCCACTTCCCAGCTAC
                      ____________________________________________________________
consensus CCCTCCATTGTCTAAAATTTGGAGATCAATACGGATAGACCAAACCCACTTCCCAGCTAC
 
. : . : . : . : . : . :
JMFF040I22+ AACACAGAGAGATTCAGTGTCCACAGCTCTGCTTTCCCTTAGACCGCGATCAATTACGCG
JMFF034H19+ AACACAGAGAGATTCAGTGTCCACAGCTCTGCTTTCCCTTAGACCGCGATCAATTACGCG
JMFF031O20+ AACACAGAGAGATTCAGTGTCCACAGCTCTGCTTTCCCTTAGACCGCGATCAATTACGCG
JMFF011I09+ AACACAGAGAGATTCAGTGTCCACAGCTCTGCTTTCCCTTAGACCGCGATCAATTACGCG
JMSF005K24+ CGCG
                      ____________________________________________________________
consensus AACACAGAGAGATTCAGTGTCCACAGCTCTGCTTTCCCTTAGACCGCGATCAATTACGCG
 
. : . : . : . : . : . :
JMFF040I22+ TCCCAACTCAATAGCAGACTCTCCAGGACGACCTGCCTCAAATGAAGGATCAGCCATAGG
JMFF034H19+ TCCCAACTCAATAGCAGACTCTCCAGGACGACCTGCCTCAAATGAAGGATCAGCCATAGG
JMFF031O20+ TCCCAACTCAATAGCAGACTCTCCAGGACGACCTGCCTCAAATGAAGGATCAGCCATAGG
JMFF011I09+ TCCCAACTCAATAGCAGACTCTCCAGGACGACCTGCCTCAAATGAAGGATCAGCCATAGG
JMSF005K24+ TCCCAACTCAATAGCAGACTCTCCAGGACGACCTGCCTCAAATGAAGGATCAGCCATAGG
                      ____________________________________________________________
consensus TCCCAACTCAATAGCAGACTCTCCAGGACGACCTGCCTCAAATGAAGGATCAGCCATAGG
 
. : . : . : . : . : . :
JMFF040I22+ AGAAAACTCAGTATAGATTGCAAGGCTCCCCTCGTTTGGCCTGTCTCGATAAGGTTGCAC
JMFF034H19+ AGAAAACTCAGTATAGATTGCAAGGCTCCCCTCGTTTGGCCTGTCTCGATAAGGTTGCAC
JMFF031O20+ AGAAAACTCAGTATAGATTGCAAGGCTCCCCTCGTTTGGCCTGTCTCGATAAGGTTGCAC
JMFF011I09+ AGAAAACTCAGTATAGATTGCAAGGCTCCCCTCGTTTGGCCTGTCTCGATAAGGTTGCAC
JMSF005K24+ AGAAAACTCAGTATAGATTGCAAGGCTCCCCTCGTTTGGCCTGTCTCGATAAGGTTGCAC
                      ____________________________________________________________
consensus AGAAAACTCAGTATAGATTGCAAGGCTCCCCTCGTTTGGCCTGTCTCGATAAGGTTGCAC
 
. : . : . : . : . : . :
JMFF040I22+ TAGTTGTGAAGACACAAAACCCATAACATGAGTTTGACCCAGCTGCACCTCTGATGAGCC
JMFF034H19+ TAGTTGTGAAGACACAAAACCCATAACATGAGTTTGACCCAGCTGCACCTCTGATGAGCC
JMFF031O20+ TAGTTGTGAAGACACAAAACCCATAACATGAGTTTGACCCAGCTGCACCTCTGATGAGCC
JMFF011I09+ TAGTTGTGAAGACACAAAACCCATAACATGAGTTTGACCCAGCTGCACCTCTGATGAGCC
JMSF005K24+ TAGTTGTGAAGACACAAAACCCATAACATGAGTTTGACCCAGCTGCACCTCTGATGAGCC
                      ____________________________________________________________
consensus TAGTTGTGAAGACACAAAACCCATAACATGAGTTTGACCCAGCTGCACCTCTGATGAGCC
 
. : . : . : . : . : . :
JMFF040I22+ ATCTTCTCTACCAAACTTGATATTGAGCTTCCGGTAATCGAAAGGGCGCCGTCCGTCGAC
JMFF034H19+ ATCTTCTCTACCAAACTTGATATTGAGCTTCCGGTAATCGAAAGGGCGCCGTCCGTCGAC
JMFF031O20+ ATCTTCTCTACCAAACTTGATATTGAGCTTCCGGTAATCGAAAGGGCGCCGTCCGTCGAC
JMFF011I09+ ATCTTCTCTACCAAACTTGATATTGAGCTTCCGGTAATCGAAAGGGCGCCGTCCGTCGAC
JMSF005K24+ ATCTTCTC----AAACTTGATATTGAGCTTCCGGTAATCGAAAGGGCGCCGTCCGTCGAC
                      ____________________________________________________________
consensus ATCTTCTCTACCAAACTTGATATTGAGCTTCCGGTAATCGAAAGGGCGCCGTCCGTCGAC
 
. : . : . : . : . : . :
JMFF040I22+ TCTGAGGTCGGAAAGCAATGCAGTTTCGATAAACTTCTTCTCATTCACAGTCATCCGCCA
JMFF034H19+ TCTGAGGTCGGAAAGCAATGCAGTTTCGATAAACTTCTTCTCATTCACAGTCATCCGCCA
JMFF031O20+ TCTGAGGTCGGAAAGCAATGCAGTTTCGATAAACTTCTTCTCATTCACAGTCATCCGCCA
JMFF011I09+ TCTGAGGTCGGAAAGCAATGCAGTTTCGATAAACTTCTTCTCATTCACAGTCATCCGCCA
JMSF005K24+ TCTGAGGTCGGAAAGCAATGCAGTTTCGATAAACTTCTTCTCATTCACAGTCATCCGCCA
                      ____________________________________________________________
consensus TCTGAGGTCGGAAAGCAATGCAGTTTCGATAAACTTCTTCTCATTCACAGTCATCCGCCA
 
. : . : . : . : . : . :
JMFF040I22+ TGTATTAACCAATCTTTGCTCCATATTTGTCTGAAGGTGATCGATGGTGAAAGAAGCGC
JMFF034H19+ TGTATTAACCAATCTTTGCTCCATATTTGTCTGAAGGTGATCGATGGTGAAAGAAGCGC
JMFF031O20+ TGTATTAACCAATCTTTGCTCCATATTTGTCTGAAGGTGATCGATGGTGAAAGAAGCGC
JMFF011I09+ TGTATTAACCAATCTTTGCTCCATATTTGTCTGAAGGTGATCGATGGTGAAAGAAGCGC
JMSF005K24+ TGTATTAACCAATCTTTGCTCCATATTTGTCTGAAGGTGATCGATGGTGAAAGAAGCGCC
                      ____________________________________________________________
consensus TGTATTAACCAATCTTTGCTCCATATTTGTCTGAAGGTGATCGATGGTGAAAGAAGCGCC