Previous Contig 004729:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013L22Sequence558004729 (23)gb:AF108883_17686408e-78Capsicum annuum small GTP-binding protein mRNA, complete cds.776004729 (23)gb:AF108883_17686406e-79Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMFF014M22Sequence583004729 (23)gb:AF108883_17686402e-78Capsicum annuum small GTP-binding protein mRNA, complete cds.222004729 (23)
JMFF020H16Sequence586004729 (23)gb:AF108883_17686405e-79Capsicum annuum small GTP-binding protein mRNA, complete cds.773004729 (23)gb:AF108883_17686407e-89Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMFF023K12Sequence479004729 (23)gb:PEAGTPBP09_16996913e-54Pisum sativum mRNA for GTP-binding protein, complete cds, clone:pra9A.777004729 (23)gb:AF108883_17686404e-84Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMFF051L05Sequence637004729 (23)gb:AF108883_17686402e-85Capsicum annuum small GTP-binding protein mRNA, complete cds.611004729 (23)gb:AF108883_17686401e-49Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF005K18Sequence423004729 (23)gb:AF108883_17686401e-47Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF008K17Sequence408004450 (21)gb:STU488941_17230896e-43Solanum tuberosum mRNA for putative mitochondrial NAD-dependent malate dehydroge701004729 (23)gb:AF108883_17686401e-74Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF016K19Sequence404004729 (23)733011909 (5)gb:AF108883_17686405e-59Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF023F18Sequence654004729 (23)gb:AF108883_17686401e-88Capsicum annuum small GTP-binding protein mRNA, complete cds.775004729 (23)gb:AF108883_17686407e-89Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF034K18Sequence656004729 (23)gb:AF108883_17686401e-88Capsicum annuum small GTP-binding protein mRNA, complete cds.754004729 (23)gb:AF108883_17686403e-86Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF036O10Sequence648004729 (23)gb:AF108883_17686401e-87Capsicum annuum small GTP-binding protein mRNA, complete cds.757004729 (23)gb:AF108883_17686404e-81Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF049N05Sequence655004729 (23)gb:AF108883_17686401e-88Capsicum annuum small GTP-binding protein mRNA, complete cds.736004729 (23)gb:AF108883_17686402e-85Capsicum annuum small GTP-binding protein mRNA, complete cds.
JMSF052N19Sequence648004729 (23)gb:AF108883_17686401e-87Capsicum annuum small GTP-binding protein mRNA, complete cds.861004729 (23)gb:AF108883_1768640e-106Capsicum annuum small GTP-binding protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051L05- ACCCTGGAGAGTTTTT
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTT
 
. : . : . : . : . : . :
rJMFF051L05- TTTTTTTTTTTATGCCAATCATTATATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
rJMSF023F18- CATTATATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
rJMSF034K18- GAGCAAGTTGCAATTCTTCACAA
rJMSF049N05- AGTTGCAATTCTTCACAA
rJMSF008K17- GCAAGTTGCAATTCTTCANAA
rJMFF020H16- CATTATATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
rJMSF036O10- AGAGCAAGTTGCAATTCTTCACAA
rJMFF023K12- CATTATATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
rJMFF014M22- TATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
rJMFF013L22- TTATATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
rJMSF052N19- AGAGCAAGTTGCAATTCTTCACAA
                      ____________________________________________________________
consensus TTTTTTTTTTTATGCCAATCATTATATTGATAAACAAGAGCAAGTTGCAATTCTTCACAA
 
. : . : . : . : . : . :
rJMFF051L05- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMSF023F18- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMSF034K18- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMSF049N05- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMSF008K17- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMFF020H16- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMSF036O10- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMFF023K12- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMFF014M22- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMFF013L22- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
rJMSF052N19- TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
                      ____________________________________________________________
consensus TGCTTTAGGCTTTTTGGTTCTTCGATTATCCAAGCATTCAAATCACTAACAACAAAAGTT
 
. : . : . : . : . : . :
rJMFF051L05- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMSF023F18- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMSF034K18- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMSF049N05- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMSF008K17- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMFF020H16- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMSF036O10- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMFF023K12- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMFF014M22- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMFF013L22- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
rJMSF052N19- AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
                      ____________________________________________________________
consensus AATAAGCTACTAAGTAAAAGTCTAATAATGACTTCCTTCTGATGCAACATCATCCTTAAA
 
. : . : . : . : . : . :
rJMFF051L05- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMSF023F18- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMSF034K18- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMSF049N05- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMSF008K17- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMFF020H16- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMSF036O10- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMFF023K12- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMFF014M22- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCACTATA
rJMFF013L22- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
rJMSF052N19- GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
                      ____________________________________________________________
consensus GTAAACCCCACCCTGTATAATTTGCACTCTGTAATTTGAGAAGGCTCTAAACCCAGTATA
 
. : . : . : . : . : . :
rJMFF051L05- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMSF023F18- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMSF034K18- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMSF049N05- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMSF008K17- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCANCAGCCACCCTTCTGGTTAACGG
rJMFF020H16- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMSF036O10- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMFF023K12- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMFF014M22- GTCTAT
rJMFF013L22- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
rJMSF052N19- GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
                      ____________________________________________________________
consensus GTCTATGCAGGGCCTAGCATAATGCCTAAGAAGAGCAGCAGCCACCCTTCTGGTTAACGG
 
. : . : . : . : . : . :
rJMFF051L05- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMSF023F18- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMSF034K18- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMSF049N05- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMSF008K17- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMFF020H16- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMSF036O10- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMFF023K12- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCGTGCCA
rJMFF013L22- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
rJMSF052N19- GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
                      ____________________________________________________________
consensus GCTGTCCTCGAATCTGCACTGTTGGTGGCTTGGCATTGCTCCCCGCTGGTTGGCTTGCCA
 
. : . : . : . : . : . :
rJMFF051L05- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMSF023F18- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMSF034K18- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMSF049N05- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMSF008K17- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMFF020H16- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMSF036O10- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMFF023K12- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMFF013L22- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
rJMSF052N19- TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
JMSF034K18+ TCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
JMSF023F18+ TTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
JMSF052N19+ ATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
JMSF036O10+ ATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
JMFF051L05+ ATATCAGCTGACATTGCCATGAAAGCTGTTTCACCATTACTGGCATTCT
JMSF049N05+ CTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
                      ____________________________________________________________
consensus TCCTCTTCTTTATATCAGCTGACATTGCCATGAAAGCTTGTTCAACATTACTGGCATTCT
 
. : . : . : . : . : . :
rJMFF051L05- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMSF023F18- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMSF034K18- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMSF049N05- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMSF008K17- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMFF020H16- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMSF036O10- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMFF023K12- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMFF013L22- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
rJMSF052N19- TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMSF034K18+ TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMSF023F18+ TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMSF052N19+ TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMSF036O10+ TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMFF051L05+ TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMFF020H16+ CCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMFF013L22+ ATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMFF014M22+ TGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
JMSF049N05+ TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
                      ____________________________________________________________
consensus TTGCACTGGTCTCCATGAATGGAATGCCAATTTCATCAGCAAAGGCCTTAGCAGTATCAT
 
. : . : . : . : . : . :
rJMFF051L05- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCNCACCAGAAGCTTGTTCACAT
rJMSF023F18- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMSF034K18- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMSF049N05- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMSF008K17- AGGACACAGCCCGGTTGTCTGTCAGATCANACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMFF020H16- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMSF036O10- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMFF023K12- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMFF013L22- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
rJMSF052N19- AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMSF034K18+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMSF023F18+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMSF052N19+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMSF036O10+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMFF051L05+ AGGACACAGCCCGGTNGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMFF020H16+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMFF013L22+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMFF023K12+ AT
JMFF014M22+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
JMSF049N05+ AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
                      ____________________________________________________________
consensus AGGACACAGCCCGGTTGTCTGTCAGATCAGACTTATTTCCAACCAGAAGCTTGTTCACAT
 
. : . : . : . : . : . :
rJMFF051L05- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCT
rJMSF023F18- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMSF034K18- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMSF049N05- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMSF008K17- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMFF020H16- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMSF036O10- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMFF023K12- TTTCACTTGCATAGCGATCAATTTCATT-TACCATTGCTTAACATTATTGAAGCTTTCTT
rJMFF013L22- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
rJMSF052N19- TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMSF034K18+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMSF023F18+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMSF052N19+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMSF036O10+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMFF051L05+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMFF020H16+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMFF013L22+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMFF023K12+ TTTCACTTGCATAGCGATCAATTTCATT-TACCATTGCTTAACATTATTGAAGCTTTCTT
JMFF014M22+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMSF049N05+ TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
JMSF005K18+ TCTT
                      ____________________________________________________________
consensus TTTCACTTGCATAGCGATCAATTTCATTCAACCATTGCTTAACATTATTGAAGCTTTCTT
 
. : . : . : . : . : . :
rJMSF023F18- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMSF034K18- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMSF049N05- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMSF008K17- GATCAGTTATGNCATAAACTATTATAATGCCATGTGCTCCTCGGNAGTAACTACTGGTAA
rJMFF020H16- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMSF036O10- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMFF023K12- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMFF013L22- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
rJMSF052N19- GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMSF034K18+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMSF023F18+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMSF052N19+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMSF036O10+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMFF051L05+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMFF020H16+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMFF013L22+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMFF023K12+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMFF014M22+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMSF049N05+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
JMSF005K18+ GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
                      ____________________________________________________________
consensus GATCAGTTATGTCATAAACTATTATAATGCCATGTGCTCCTCGGTAGTAACTACTGGTAA
 
. : . : . : . : . : . :
rJMSF023F18- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMSF034K18- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMSF049N05- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMSF008K17- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTNAATTGTCTTCCCAT
rJMFF020H16- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMSF036O10- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMFF023K12- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMFF013L22- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
rJMSF052N19- TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMSF034K18+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMSF023F18+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMSF052N19+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMSF036O10+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMFF051L05+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMFF020H16+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMFF013L22+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMFF023K12+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMFF014M22+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMSF049N05+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
JMSF005K18+ TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
                      ____________________________________________________________
consensus TTGTCCGGAAGCGTTCTTGCCCAGCAGTGTCCCAAATTTGAAGTTTAATTGTCTTCCCAT
 
. : . : . : . : . : . :
rJMSF023F18- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
rJMSF034K18- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCC-AA
rJMSF049N05- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTANCTGTCC
rJMSF008K17- CTTGGTCCACAGTGCG-AATT
rJMFF020H16- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
rJMSF036O10- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACA-CAATTGTGCTAATGTANCTGTCC-AA
rJMFF023K12- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
rJMFF013L22- CTTGGTCCACAGTGCGAAATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
rJMSF052N19- CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMSF034K18+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMSF023F18+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMSF052N19+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMSF036O10+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMFF051L05+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMFF020H16+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMFF013L22+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMFF023K12+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMFF014M22+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMSF049N05+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
JMSF005K18+ CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
                      ____________________________________________________________
consensus CTTGGTCCACAGTGCG-AATTTTAAAGTCAACACCAATTGTGCTAATGTAACTGTCCAAA
 
. : . : . : . : . : . :
rJMSF023F18- TATGAATCATCAG
rJMSF034K18- TATGAATCATCAG
rJMFF020H16- TATGAATCATCAG
rJMSF036O10- TATGAATCATCAGCAA
rJMFF023K12- TATGAATCATCAGCAAA
rJMFF013L22- TATGAATCATCAGCAAA
rJMSF052N19- TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMSF034K18+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMSF023F18+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMSF052N19+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMSF036O10+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMFF051L05+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMFF020H16+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMFF013L22+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMFF023K12+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMFF014M22+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMSF049N05+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
JMSF005K18+ TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
                      ____________________________________________________________
consensus TATGAATCATCAGCAAACCTCAGAAGCAGGCATGACTTTCCAACACCTGAATCTCCTATA
 
. : . : . : . : . : . :
rJMSF052N19- AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAA
JMSF034K18+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMSF023F18+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMSF052N19+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMSF036O10+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMFF051L05+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMFF020H16+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMFF013L22+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMFF023K12+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMFF014M22+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMSF049N05+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMSF016K19+ TATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
JMSF005K18+ AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
                      ____________________________________________________________
consensus AGCAAAAGCTTGAACAAGTAGTCATATTCGGGATTCATGATGAAGTCTGCTGATCCAACA
 
. : . : . : . : . : . :
JMSF034K18+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMSF023F18+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMSF052N19+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMSF036O10+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMFF051L05+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMFF020H16+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMFF013L22+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMFF023K12+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMFF014M22+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMSF049N05+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMSF016K19+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
JMSF005K18+ GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
                      ____________________________________________________________
consensus GTGAAGGCGCCGGAATGAAACGCTCCCGACAGCCGGAGATCGTTGTCGGAATCTTGATCG
 
. : . : . : . : . : . :
JMSF034K18+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGT
JMSF023F18+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTT
JMSF052N19+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTCC
JMSF036O10+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGT
JMFF051L05+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAAT
JMFF020H16+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTC
JMFF013L22+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTA
JMFF023K12+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTC
JMFF014M22+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTC
JMSF049N05+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTCC
JMSF016K19+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTCC
JMSF005K18+ TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTCC
                      ____________________________________________________________
consensus TCGTCGAAACTGTGTTACGAAAGAGGTCGTGAAAGTAGATTGGAAGAATAAAAGAGTTCC