Previous Contig 004728:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005K16Sequence217004728 (3)
JMSF032A09Sequence158004728 (3)112023508
JMSF042D05Sequence216004728 (3)349023975gb:LES012796_16844617e-04Lycopersicon esculentum mRNA for ss-galactosidase, clone tEG1A.>gb:AF154421_1772

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042D05+ TTCCTTTNTGGGCAATGCCCCTTTTTCTT
JMSF005K16+ TTTTNTTNTTCCTTTNTGGGCAANGCCCCTTNTTCTT
                      ____________________________________________________________
consensus TTTTNTTNTTCCTTTNTGGGCAATGCCCCTTTTTCTT
 
. : . : . : . : . : . :
JMSF042D05+ TAATTTCCCNCTTTATTCTATGCTCTTTTTTTTTCTCTATCTTCTAGAGAGAGAGACAAA
JMSF032A09+ TCTTTTTTTTTCTCTATCTTCTAGAGAGNGAGACAAA
JMSF005K16+ TAATTTCCCNCTTTATTCTATGCTCTTTTTTTTTCTCTATCTTCTAGAGAGAGAGACAAA
                      ____________________________________________________________
consensus TAATTTCCCNCTTTATTCTATGCTCTTTTTTTTTCTCTATCTTCTAGAGAGAGAGACAAA
 
. : . : . : . : . : . :
JMSF042D05+ GAAGGGCTGCTTTTGTTGTCTTGAGATTTTTTTTTTTATTCCTTTTTTAAGCGTACAGAT
JMSF032A09+ GAAGGGCTGCTTTTGTTGTCTTGNGATTTTTTTTTTTATTCCTTTTTTAAGCGTACAGAT
JMSF005K16+ GAAGGGCTGCTTTTGTTGTCTTGAGATTTTTTTTTTTATTCCTTTTTTAAGCGTACAGAT
                      ____________________________________________________________
consensus GAAGGGCTGCTTTTGTTGTCTTGAGATTTTTTTTTTTATTCCTTTTTTAAGCGTACAGAT
 
. : . : . : . : . : . :
JMSF042D05+ GCAGAGAAACGTAGTGTGGTGAGAGAGTGTGTGCGTGATTAATTGTAGCTTGAAACT
JMSF032A09+ GCAGAGAAACGTAGTGTGGTGAGAGAGTGTGTGCGTGATTAATTGTAGCTTGAAACT
JMSF005K16+ GCAGAGAAACGTAGTGTGGTGAGAGAGTGTGTGCGTGATTAATTGTAGCTTGAAACTTCC
                      ____________________________________________________________
consensus GCAGAGAAACGTAGTGTGGTGAGAGAGTGTGTGCGTGATTAATTGTAGCTTGAAACTTCC