Previous Contig 004723:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A06Sequence578004723 (14)gb:AY088029_15730532e-47Arabidopsis thaliana clone 40534 mRNA, complete sequence.747013297 (13)gb:AB023045_15155091e-51Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638
JMFF006E06Sequence557004723 (14)gb:AY088029_15730531e-37Arabidopsis thaliana clone 40534 mRNA, complete sequence.775013297 (13)gb:AB023045_15155092e-55Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638
JMFF008K24Sequence517004723 (14)gb:AY088029_15730532e-32Arabidopsis thaliana clone 40534 mRNA, complete sequence.620013297 (13)gb:AY863145_16309881e-39Flaveria brownii unknown mRNA.
JMFF014D09Sequence558004723 (14)gb:AY088029_15730532e-38Arabidopsis thaliana clone 40534 mRNA, complete sequence.848013297 (13)gb:AB023045_15155096e-66Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638
JMFF018L13Sequence558004723 (14)gb:AY088029_15730531e-37Arabidopsis thaliana clone 40534 mRNA, complete sequence.705013297 (13)gb:AY863145_16309886e-46Flaveria brownii unknown mRNA.
JMFF031J21Sequence139004723 (14)285013297 (13)pir|A96555|A965550.004unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_893077 Arabidopsis
JMFF032E09Sequence604004723 (14)gb:AY088029_15730534e-39Arabidopsis thaliana clone 40534 mRNA, complete sequence.702013297 (13)gb:AY863145_16309884e-48Flaveria brownii unknown mRNA.
JMFF033J18Sequence511004723 (14)gb:AY088029_15730536e-31Arabidopsis thaliana clone 40534 mRNA, complete sequence.743013297 (13)gb:AB023045_15155093e-51Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638
JMSF005K03Sequence355004723 (14)gb:AY088029_15730531e-10Arabidopsis thaliana clone 40534 mRNA, complete sequence.324013297 (13)
JMSF012O08Sequence376004723 (14)283007329 (41)gb:AF428455_17993855e-18Arabidopsis thaliana AT4g38970/F19H22_70 mRNA, complete cds.
JMSF018N13Sequence261004723 (14)gb:AY088029_15730531e-07Arabidopsis thaliana clone 40534 mRNA, complete sequence.752013297 (13)gb:AY863145_16309882e-49Flaveria brownii unknown mRNA.
JMSF019H07Sequence257004723 (14)gb:AY088029_15730531e-07Arabidopsis thaliana clone 40534 mRNA, complete sequence.749013297 (13)gb:AB023045_15155094e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638
JMSF040J09Sequence639004723 (14)gb:AY088029_15730535e-44Arabidopsis thaliana clone 40534 mRNA, complete sequence.874013297 (13)gb:AB023045_15155098e-63Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638
JMSF052N18Sequence649004723 (14)gb:AY088029_15730537e-46Arabidopsis thaliana clone 40534 mRNA, complete sequence.873013297 (13)gb:AB023045_15155092e-62Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.>gb:BT005762_1638

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004A06+ TTC
JMSF052N18+ TCGGCTCAATATTTTCTGCAATATGCTCTTC
                      ____________________________________________________________
consensus TCGGCTCAATATTTTCTGCAATATGCTCTTC
 
. : . : . : . : . : . :
JMFF014D09+ TCACTACCGCAAGG-TTTTTGAAGAGAGCACAGTGGGCTC
JMFF004A06+ AGTAACCCTATTTGGAACCTTCACTACCGCAAGGTTTTTTGAAGAGAGCACAGTGGGCTC
JMSF052N18+ AGTAACCCTATTTGGAACCTTCACTACCGCAAGGTTTTTTGAAGAGAGCACAGTGGGCTC
JMFF032E09+ GAAGAGAGCACAGTGGGCTC
JMSF040J09+ TCACTACCGCAAGGTTTTTTGAAGAGAGCACAGTGGGCTC
                      ____________________________________________________________
consensus AGTAACCCTATTTGGAACCTTCACTACCGCAAGGTTTTTTGAAGAGAGCACAGTGGGCTC
 
. : . : . : . : . : . :
JMFF014D09+ AGATGCTGTGACTTTGACCACTCCATCCCAGGCTTTTAACAAACTGATCAACATCATAAA
JMFF004A06+ AGATGCTGTGACTTTGACCACTCCAT-CCAGGCTTTTAACAAACTGATCAACATCATAAA
JMSF052N18+ AGATGCTGTGACTTTGACCACTCCAT-CCAGGCTTTTAACAAACTGATCAACAT-ATAAA
JMFF032E09+ AGATGCTGTGACTTTGACCACTCCATCCCAGGCTTTTAACAAACTGATCAACATCATAAA
JMFF006E06+ AACAAACTGATCAACATCATAAA
JMFF018L13+ TAACAAACTGATCAACATCATAAA
JMSF040J09+ AGATGCTGTGACTTTGACCACTCCAT-CCAGGCTTTTAACAAACTGATCAACATCATAAA
                      ____________________________________________________________
consensus AGATGCTGTGACTTTGACCACTCCAT-CCAGGCTTTTAACAAACTGATCAACATCATAAA
 
. : . : . : . : . : . :
JMFF014D09+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMFF004A06+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMSF052N18+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMFF032E09+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMFF008K24+ TTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMFF033J18+ CCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMFF006E06+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMFF018L13+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
JMSF040J09+ TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
                      ____________________________________________________________
consensus TGTCTTTGAAGTCTCTCTTATCACCAGGATTGCTTCCCCTAACATCTGGGATCACAAGAG
 
. : . : . : . : . : . :
JMFF014D09+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMFF004A06+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMSF052N18+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMFF032E09+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMFF008K24+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMFF033J18+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMFF006E06+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMFF018L13+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
JMSF040J09+ TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
                      ____________________________________________________________
consensus TTGCACGTAGATATCTTGCCACTACTACTGCATCAGAAATCTGTGAGACATGATACTCGG
 
. : . : . : . : . : . :
JMFF014D09+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMSF012O08+ CCATCAGCCAGGGATG
JMFF004A06+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMSF052N18+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMFF032E09+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMFF008K24+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMFF033J18+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMFF006E06+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMFF018L13+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
JMSF040J09+ GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
                      ____________________________________________________________
consensus GACCATTGGTCAGCGAGAAGGTCACATATCCATTTGATAAATCTCCATCAGCCAGGGATG
 
. : . : . : . : . : . :
JMFF014D09+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMSF012O08+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMFF004A06+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMSF052N18+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMFF032E09+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMFF008K24+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMFF033J18+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMFF006E06+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMFF018L13+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMSF040J09+ GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
JMSF005K03+ TCCCAGCAGGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
                      ____________________________________________________________
consensus GTCTTTCCCAGCAAGGCTTCATGGATAAACCATCACCTTTCCAAAGACTATCTCCCCCAG
 
. : . : . : . : . : . :
JMFF014D09+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMSF012O08+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMFF004A06+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMSF052N18+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMFF032E09+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMFF008K24+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMFF033J18+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMSF018N13+ CATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMFF006E06+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMFF018L13+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMSF040J09+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
JMSF019H07+ AGTCAAGCGGCTCTCCT
JMSF005K03+ GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
                      ____________________________________________________________
consensus GAAGTGAAAGCTCTGAAGCTTTGTTAGTATCATGAATAGTTGAAGTCAAGCGGCTCTCCT
 
. : . : . : . : . : . :
JMFF014D09+ GGAGAGTATCGAAGTGGCCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMSF012O08+ G
JMFF004A06+ GGAGAGTATCGAAGTGGCCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMSF052N18+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMFF032E09+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMFF008K24+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMFF033J18+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMSF018N13+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMFF006E06+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMFF018L13+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMSF040J09+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMSF019H07+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
JMSF005K03+ GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
                      ____________________________________________________________
consensus GGAGAGTATCGAAGTGGTCTCGCTTGATCATGTTCCCCAGCATTACAAACATTGTAACAG
 
. : . : . : . : . : . :
JMFF014D09+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF004A06+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMSF052N18+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF031J21+ TGAGCACTCCGGCCACAATCTGTCTNGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF032E09+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF008K24+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF033J18+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMSF018N13+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF006E06+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMFF018L13+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMSF040J09+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMSF019H07+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
JMSF005K03+ TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
                      ____________________________________________________________
consensus TGAGCACTCCGGCCACAATCTGTCTCGGATCCACCGCCATTTCTTCAGATCCAAAATCTC
 
. : . : . : . : . : . :
JMFF014D09+ TCTCCTGCTTTCACTGTATCAAAGAATCACGTTCTT
JMFF004A06+ TCTCCTGCTTTCACTGTATCAAAGAATCACGTTCTT
JMSF052N18+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMFF031J21+ TCTCCTGCTTTCACTGTATCAAAGAGCCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMFF032E09+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMFF008K24+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMFF033J18+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMSF018N13+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMFF006E06+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMFF018L13+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMSF040J09+ TCTCCTGCTTTCACTGTATCAAGGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMSF019H07+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
JMSF005K03+ TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
                      ____________________________________________________________
consensus TCTCCTGCTTTCACTGTATCAAAGAACCACCTTCTTCTCTCTGTGTATAGAGAGAGATTG
 
. : . : . : . : . : . :
JMSF052N18+ AGAAGAGAGAAAGAGGCGC
JMFF031J21+ AGAAGAGAGAAAGAGGCG
JMFF032E09+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCT
JMFF008K24+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATT
JMFF033J18+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATT
JMSF018N13+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGT
JMFF006E06+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATT
JMFF018L13+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTGGTAATT
JMSF040J09+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATT
JMSF019H07+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATT
JMSF005K03+ AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATTAAGCCC
                      ____________________________________________________________
consensus AGAAGAGAGAAAGAGGCGCAGCTCACACCTTAGCTTTCTTGGCTACTTGTAATTAAGCCC