Previous Contig 004722:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS119G08Sequence642004722 (6)gb:AY085598_15706668e-31Arabidopsis thaliana clone 15906 mRNA, complete sequence.
JMFS130A07Sequence599004722 (6)gb:AY085598_15706666e-24Arabidopsis thaliana clone 15906 mRNA, complete sequence.
JMFS145E07Sequence617004722 (6)gb:AY085598_15706665e-39Arabidopsis thaliana clone 15906 mRNA, complete sequence.
JMSF005K02Sequence306004722 (6)
JMSF006A17Sequence237004722 (6)404011336 (2)gb:AP005012_18472742e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMSF020A21Sequence201004722 (6)777010027 (3)gb:AY085598_15706661e-51Arabidopsis thaliana clone 15906 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS145E07+ TATTTACATCAATTCCAGTTGTAAGTCTAGGAAGCAAATCAATGGCATCAGCAATATTCT
JMFS119G08+ CAATGGCATCAGCAATATTCT
                      ____________________________________________________________
consensus TATTTACATCAATTCCAGTTGTAAGTCTAGGAAGCAAATCAATGGCATCAGCAATATTCT
 
. : . : . : . : . : . :
JMFS145E07+ GCTGCTGATTCTCAACATAACCGGCATCTTTGTCATTGACATTACTGTTTGAATCAATAA
JMFS130A07+ ACCGGCATCTTTGTCATTGACATTACTGTTTGAATCAATAA
JMFS119G08+ GCTGCTGATTCTCAACATAACCGGCATCTTGGTCATTGACATTACTGTTTGAATCAATAA
                      ____________________________________________________________
consensus GCTGCTGATTCTCAACATAACCGGCATCTTTGTCATTGACATTACTGTTTGAATCAATAA
 
. : . : . : . : . : . :
JMFS145E07+ GCCGCTCTGCAACAAGAGATAGCAGTTTTTCCTGTGAAACCTCGGGGACATCAGGACTCA
JMFS130A07+ GCCGCTCTGCAACAAGAGATAGCAGTTTTTCCTGTGAAACCTCGGGGACATCAGGACTCA
JMFS119G08+ GCCGCTCTGCAACAAGAGATAGCAGTTTTTCCTGTGAAACCTCGGGGACATCAGGACTCA
                      ____________________________________________________________
consensus GCCGCTCTGCAACAAGAGATAGCAGTTTTTCCTGTGAAACCTCGGGGACATCAGGACTCA
 
. : . : . : . : . : . :
JMFS145E07+ AATTCAAGTTGTTCTTCAACAGGAGCACATTGCAGATTGCAAGAAGAGGGCAAGGGCCAT
JMFS130A07+ AATTCAAGTTGTTCTTCAACAGGAGCACATTGCAGATTGCAAGAAGAGGGCAAGGGCCAT
JMFS119G08+ AATTCAAGTTGTTCTTCAACAGGAGCACATTGCAGATTGCAAGAAGAGGGCAAGGGCCAT
                      ____________________________________________________________
consensus AATTCAAGTTGTTCTTCAACAGGAGCACATTGCAGATTGCAAGAAGAGGGCAAGGGCCAT
 
. : . : . : . : . : . :
JMFS145E07+ TGTCATTCTGGAGAATGATGGGAGTCGTTCTGCCCAGAAACTGAATAACCTTGGTCTTGT
JMFS130A07+ TGTCATTCTGGAGAATGATGGGAGTCGTTCTGCCCAGAAACTGAATAACCTTGGTCTTGT
JMFS119G08+ TGTCATTCTGGAGAATGATGGGAGTCGTTCTGCCCAGAAACTGAATAACCTTGGTCTTGT
                      ____________________________________________________________
consensus TGTCATTCTGGAGAATGATGGGAGTCGTTCTGCCCAGAAACTGAATAACCTTGGTCTTGT
 
. : . : . : . : . : . :
JMFS145E07+ GGACCATTTCCTTCTCTTTGGTCGCAGCCGGCGCAGGCTCGTCTCGATTCTGGCTTTCCT
JMFS130A07+ GGACCATTTCCTTCTCTTTGGTCGCAGCCGGCGCAGGCTCGTCTCGATTCTGGCTTTCCT
JMFS119G08+ GGACCATTTCCTTCTCTTTGGTCGCAGCCGGCGCAGGCTCGTCTCGATTCTGGCTTTCCT
                      ____________________________________________________________
consensus GGACCATTTCCTTCTCTTTGGTCGCAGCCGGCGCAGGCTCGTCTCGATTCTGGCTTTCCT
 
. : . : . : . : . : . :
JMFS145E07+ CCTGCATCGCATCGGCTGCCGGCGTCGTCGCCGTCGTGGAAGAAGAGGGAGCCGCAGAAA
JMFS130A07+ CCTGCATCGCATCGGCTGCCGGCGTCGTCGCCGTCGTGGAAGAAGAGGGAGCCGCAGAAA
JMFS119G08+ CCTGCATCGCATCGGCTGCCGGCGTCGTCGCCGTCGTGGAAGAAGAGGGAGCCGCAGAAA
                      ____________________________________________________________
consensus CCTGCATCGCATCGGCTGCCGGCGTCGTCGCCGTCGTGGAAGAAGAGGGAGCCGCAGAAA
 
. : . : . : . : . : . :
JMFS145E07+ AAGACATTTCAGGGAGAAAAAAAAAAAAAATTGAATCGGCAAATTGGGCACACGGGATTT
JMSF020A21+ GAAAAAAAAAAAAAATTGAATCGGCAAATTGGGCACACGGGATTT
JMFS130A07+ AAGACATTTCAGGGAGAAAAAAAAAAAAAATTGAATCGGCAAATTGGGCACACGGGATTT
JMFS119G08+ AAGACATTTCAGGGAG-AAAAAAAAAAAAATTGAATCGGCAAATTGGGCACACGGGATTT
JMSF005K02+ AAAAAAAAAAAAATTGAATCGGCAAATTGGGCACACGGGATTT
                      ____________________________________________________________
consensus AAGACATTTCAGGGAGAAAAAAAAAAAAAATTGAATCGGCAAATTGGGCACACGGGATTT
 
. : . : . : . : . : . :
JMFS145E07+ ACGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
JMSF020A21+ ACGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
JMFS130A07+ ACGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
JMFS119G08+ ACGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
JMSF006A17+ CGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
JMSF005K02+ ACGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
                      ____________________________________________________________
consensus ACGTAATCTATTCCTTATCTACGACCATATAGACTGAGTATACGTAAGAGAATACAGGAT
 
. : . : . : . : . : . :
JMFS145E07+ CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
JMSF020A21+ CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
JMFS130A07+ CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
JMFS119G08+ CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
JMSF006A17+ CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
JMSF005K02+ CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
                      ____________________________________________________________
consensus CTAAACTTAACGCGAGAAAGAGAGAAAATCAGGGATTCATGACGACATATATATATATGC
 
. : . : . : . : . : . :
JMFS145E07+ TGCAAAATTAGCGTGGA
JMSF020A21+ TGCAAAATTAGCGTGGAGAAAGTGGTAGC
JMFS130A07+ TGCAAAATTAGCGTGGAGAAAGTGGTAGCCAAGTGAAAAGGGCACCATTTTCCCTTTTGC
JMFS119G08+ TGCAAAATTAGCGTGGAGAAAGTGGTAGCCAAGTGAAAAGGGCACCATTTTCCCTTTTGC
JMSF006A17+ TGCAAAATTAGCGTGGAGAAAGTGGTAGCCAAGTGAAAAGGGCACCATTTTCCCTTTTGC
JMSF005K02+ TGCAAAATTAGCGTGGAGAAAGTGGTAGCCAAGTGAAAAGGGCACCATTTTCCCTTTTGC
                      ____________________________________________________________
consensus TGCAAAATTAGCGTGGAGAAAGTGGTAGCCAAGTGAAAAGGGCACCATTTTCCCTTTTGC
 
. : . : . : . : . : . :
JMFS130A07+ TTTTTCTTCCTCTTTTTG
JMFS119G08+ TTTTTCTTCCTCTTTTTG
JMSF006A17+ TTTTTCTTCCTCTTTTTGCCAATTATTATCACGTCCGTATCTTCCTATTTTGAACTCC
JMSF005K02+ TTTTTCTTCCTCTTTTTGCCAATTATTATCACGTCCGTATCTTCCTATTTTGAACTCCAA
                      ____________________________________________________________
consensus TTTTTCTTCCTCTTTTTGCCAATTATTATCACGTCCGTATCTTCCTATTTTGAACTCCAA