Previous Contig 004709:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016E04Sequence603004709 (9)sp|Q9SW70|SRP_VITRI2e-47Stress-related protein.>gb:AF178990_1774735 Vitis riparia stress related protein
JMFF019L16Sequence562004709 (9)sp|Q9MA63|Y350_ARATH2e-37Hypothetical protein At3g05500.>gb:ATAC009606_1543003 Arabidopsis thaliana chrom
JMFF022P18Sequence492004709 (9)sp|Q9SW70|SRP_VITRI2e-34Stress-related protein.>gb:AF178990_1774735 Vitis riparia stress related protein
JMFF027M15Sequence511004709 (9)sp|Q9MA63|Y350_ARATH3e-51Hypothetical protein At3g05500.>gb:ATAC009606_1543003 Arabidopsis thaliana chrom126021284
JMFF035C20Sequence564004709 (9)sp|Q9MA63|Y350_ARATH7e-43Hypothetical protein At3g05500.>gb:ATAC009606_1543003 Arabidopsis thaliana chrom216004709 (9)gb:AY237010_15921068e-14Hevea brasiliensis clone A502 small rubber particle protein (SRPP) mRNA, partial
JMSF005I08Sequence361004709 (9)sp|Q9SW70|SRP_VITRI8e-25Stress-related protein.>gb:AF178990_1774735 Vitis riparia stress related protein
JMSF025N14Sequence664005537 (5)gb:AY058177_15643133e-77Arabidopsis thaliana At2g24280/F27D4.19 mRNA, complete cds.>gb:AY142011_1582848 699004709 (9)sp|Q9SW70|SRP_VITRI5e-66Stress-related protein.>gb:AF178990_1774735 Vitis riparia stress related protein
JMSF046O10Sequence767004709 (9)sp|Q9SW70|SRP_VITRI1e-65Stress-related protein.>gb:AF178990_1774735 Vitis riparia stress related protein

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025N14- AGAACTATCATTAGAAAACAATCACTCCTTTCAGCTGGTCTCCACA
                      ____________________________________________________________
consensus AGAACTATCATTAGAAAACAATCACTCCTTTCAGCTGGTCTCCACA
 
. : . : . : . : . : . :
rJMSF025N14- GGACTTCCATTGCTCAACAGATTTAGCAATCTTCTCAGTAGGCACCAATGGAAGATACGA
JMSF046O10+ TCAGTAGGCACCAATGGAAGATACGA
                      ____________________________________________________________
consensus GGACTTCCATTGCTCAACAGATTTAGCAATCTTCTCAGTAGGCACCAATGGAAGATACGA
 
. : . : . : . : . : . :
rJMSF025N14- CGCAACCTTGTACCCCTTCTCGGCACCAGCCTGAACAGTGTGGTTGTATCTCTCAGACCA
JMSF046O10+ CGCAACCTTGTACCCNTTCTCGGCACCAGCCTGAACAGTGTGGTTGTATCTCTCAGACCA
                      ____________________________________________________________
consensus CGCAACCTTGTACCCCTTCTCGGCACCAGCCTGAACAGTGTGGTTGTATCTCTCAGACCA
 
. : . : . : . : . : . :
rJMSF025N14- GTAAGAAGCTTTTGGAGCAACAGCTTGAGTAACCCTGGGAACAAGGGGGAGCTGATTCAG
JMFF016E04+ TTCAG
JMFF027M15+ GGAACAAGGGGGAGCTGATTCAG
JMSF046O10+ GTAAGAAGCTTTTGGAGCAACAGCTTGAGTAACCCTGGGAACAAGGGGGAGCTGATTCAG
                      ____________________________________________________________
consensus GTAAGAAGCTTTTGGAGCAACAGCTTGAGTAACCCTGGGAACAAGGGGGAGCTGATTCAG
 
. : . : . : . : . : . :
rJMSF025N14- AGACCGCCAAGCAGACGAAGCATACTGCTCCGCTACTGGCTCATACTTGTCATACAGCCC
JMFF035C20+ ACTGGCTCATACTTGTCATACAGCCC
JMFF019L16+ GGCTCATACTTGTCATACAGCCC
rJMFF035C20- CATACTGCTCCGCTACTGGCTCATACTTGTCATACAGCCC
JMFF016E04+ AGACCGCCAAGCAGACGAAGCATACTGCTCCGCTACTGGCTCATACTTGTCATACAGCCC
JMFF027M15+ AGACCGCCAAGCAGACGAAGCATACTGCTCCGCTACTGGCTCATACTTGTCATACAGCCC
JMSF046O10+ AGACCGCCAAGCAGACGAAGCATACTGCTCCGCTACTGGCTCATACTTGTCATACAGCCC
                      ____________________________________________________________
consensus AGACCGCCAAGCAGACGAAGCATACTGCTCCGCTACTGGCTCATACTTGTCATACAGCCC
 
. : . : . : . : . : . :
rJMSF025N14- CTTGGCAGCAG-GCTGATACTGTGTGTATACACTTCTCGCCAGAATTGAAGCAGTCTCCA
JMFF035C20+ CTTGGCAGCAG-GCTGATACTGTGTGTATACACTTCTCGCCAGAATTGAAGCAGTCTCCA
JMFF019L16+ CTTGGCAGCAGTGNTGATACTGTGTGTATACACTTCTCGCCAGAATTGAAGCAGTCTCCA
JMFF022P18+ GAAGCAGTCTCCA
rJMFF035C20- CTTGGCAGCAG-GCTGATACTGTGTGTATNCNCTTCTCGCCNGAATTGAAGNAGTCTCCA
JMFF016E04+ CTTGGCAGCAG-GCTGATACTGTGTGTATACACTTCTCGCCAGAATTGAAGCAGTCTCCA
JMFF027M15+ CTTGGCAGCAG-GCTGATACTGTGTGTATACACTTCTCGCCAGAATTGAGGCAGTCTCCA
JMSF046O10+ CTTGGCAGCAG-GCTGATACTGTGTGTATACACTTCTCGCCAGAATTGAAGCAGTCTCCA
                      ____________________________________________________________
consensus CTTGGCAGCAG-GCTGATACTGTGTGTATACACTTCTCGCCAGAATTGAAGCAGTCTCCA
 
. : . : . : . : . : . :
rJMSF025N14- CCACACCAGTACTTTTGACTTCGGCTACAACATCNCGGACGTACCCCGGAGCCATCTGTG
JMFF035C20+ CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
JMFF019L16+ CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
JMFF022P18+ CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
rJMFF035C20- CCACACCACTACTTTTGACTTCGGCTACAACATCACGGACGTNNCCCGGAGCCATCTGTG
JMFF016E04+ CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
JMFF027M15+ CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
JMSF046O10+ CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
                      ____________________________________________________________
consensus CCACACCAGTACTTTTGACTTCGGCTACAACATCACGGACGTACCCCGGAGCCATCTGTG
 
. : . : . : . : . : . :
rJMSF025N14- CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
JMFF035C20+ CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
JMFF019L16+ CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
JMFF022P18+ CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
rJMFF035C20- CATNTGAGAAAGCTCNGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTC
JMFF016E04+ CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
JMFF027M15+ CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
JMSF046O10+ CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
JMSF005I08+ T
                      ____________________________________________________________
consensus CAGTTGAGAAAGCTCGGGTTGATACCTGCTTCACAGATGGAGGTACGCGATCCTCGATTT
 
. : . : . : . : . : . :
rJMSF025N14- TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMFF035C20+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMFF019L16+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMFF022P18+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMFF016E04+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMFF027M15+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMSF046O10+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
JMSF005I08+ TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
                      ____________________________________________________________
consensus TGTGAACAGATTCATCCATCTTGCGATCAACAAACTTGAGGACTTCAGCAGGAACACTAT
 
. : . : . : . : . : . :
rJMSF025N14- GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMFF035C20+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMFF019L16+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMFF022P18+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMFF016E04+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMFF027M15+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMSF046O10+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
JMSF005I08+ GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
                      ____________________________________________________________
consensus GAACCTTATCGTAAACGGGACCAACGACGGTCTTAACGGTTCCCTCCACGGTCTGAACGC
 
. : . : . : . : . : . :
rJMSF025N14- CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMFF035C20+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMFF019L16+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMFF022P18+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMFF016E04+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMFF027M15+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMSF046O10+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
JMSF005I08+ CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
                      ____________________________________________________________
consensus CGGGCTTGAGAGGGCCCAAATTCTCCTTAGCGTAACTGTAGAGCTTTGCAGCACAGAGGA
 
. : . : . : . : . : . :
rJMSF025N14- TGGCGTGGAGCGCCGCAACTTGCACGAACTCC-AATACTTCAACCTCTGCTCCTC
JMFF035C20+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
JMFF019L16+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
JMFF022P18+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
JMFF016E04+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
JMFF027M15+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAAACTCTGCTCCTCGCTCT
JMSF046O10+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
JMSF005I08+ TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
                      ____________________________________________________________
consensus TGGCGTGGAGCGCCGCAACTTGCACGAACTCCAAATACTTCAACCTCTGCTCCTCGCTCT
 
. : . : . : . : . : . :
JMFF035C20+ GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
JMFF019L16+ GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
JMFF022P18+ GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
JMFF016E04+ GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
JMFF027M15+ GAGTCTCAA
JMSF046O10+ GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
JMSF005I08+ GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
                      ____________________________________________________________
consensus GAGTCTCAACCGTCTCGGACTGGGGTTGAGAATTAGGGCTTGTTGCTTCGGCCATGATCG
 
. : . : . : . : . : . :
JMFF035C20+ GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGT
JMFF019L16+ GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGT
JMFF022P18+ GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGT
JMFF016E04+ GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGT
JMSF046O10+ GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGT
JMSF005I08+ GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGTC
                      ____________________________________________________________
consensus GAGGACAGTAGAATCAGAAGGGTTTAGGAATGTAACGGTGAAGAAGATAGAAAGCGTGTC