Previous Contig 004708:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005H22Sequence379004708 (3)pir|G86457|G864573e-10unknown protein, 42586-33527 [imported] - Arabidopsis thaliana>gb:AE005172_89215
JMSF025E07Sequence692004708 (3)pir|G86457|G864573e-30unknown protein, 42586-33527 [imported] - Arabidopsis thaliana>gb:AE005172_89215
JMSF043D07Sequence731004708 (3)pir|G86457|G864572e-30unknown protein, 42586-33527 [imported] - Arabidopsis thaliana>gb:AE005172_89215681024023gb:AP005649_18554405e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043D07+ CACTGCAGCAA
                      ____________________________________________________________
consensus CACTGCAGCAA
 
. : . : . : . : . : . :
JMSF043D07+ CTGTCCTGCTCCTGGACATTATGCCCCATAAACGACCAAAGCCAGCATCATCACGAAGCT
JMSF025E07+ TAAACGACCAAAGCCAGCATCATCACGAAGCT
                      ____________________________________________________________
consensus CTGTCCTGCTCCTGGACATTATGCCCCATAAACGACCAAAGCCAGCATCATCACGAAGCT
 
. : . : . : . : . : . :
JMSF043D07+ CATATACAAAACCTGGAGCACTAGGTTCGACCACGCCAAGTTGGAAACAGCTGACAGATC
JMSF025E07+ CATATACAAAACCTGGAGCACTAGGTTCGACCACGCCAAGTTGGAAACAGCTGACAGATC
                      ____________________________________________________________
consensus CATATACAAAACCTGGAGCACTAGGTTCGACCACGCCAAGTTGGAAACAGCTGACAGATC
 
. : . : . : . : . : . :
JMSF043D07+ CATCATTCCTGCCAACTACTATAGACCCTGCTGTTGCTGCGACTGCCGTTATTGCTCCAT
JMSF025E07+ CATCATTCCTGCCAACTACTATAGACCCTGCTGTTGCTGCGACTGCCGTTATTGCTCCAT
                      ____________________________________________________________
consensus CATCATTCCTGCCAACTACTATAGACCCTGCTGTTGCTGCGACTGCCGTTATTGCTCCAT
 
. : . : . : . : . : . :
JMSF043D07+ GATGAGGATTCATTTGTGCATTGCACTCAATAACCTCACTAGATGGCAAAACAGAACTAG
JMSF025E07+ GATGAGGATTCATTTGTGCATTGCACTCAATAACCTCACTAGATGGCAAAACAGAACTAG
                      ____________________________________________________________
consensus GATGAGGATTCATTTGTGCATTGCACTCAATAACCTCACTAGATGGCAAAACAGAACTAG
 
. : . : . : . : . : . :
JMSF043D07+ ATATATAGGTAGAAACATCTTTAAGTTTAATAAGGTAAGCAACCCCTGAGATTGTCAAAG
JMSF025E07+ ATATATAGGTAGAAACATCTTTAAGTTTAATAAGGTAAGCAACCCCTGAGATTGTCAAAG
                      ____________________________________________________________
consensus ATATATAGGTAGAAACATCTTTAAGTTTAATAAGGTAAGCAACCCCTGAGATTGTCAAAG
 
. : . : . : . : . : . :
JMSF043D07+ CATTAAGTGTGAAATGTCCCCCAGTCAAAAGATTAGCCTGATTTTCACATATCAGAGTAA
JMSF025E07+ CATTAAGTGTGAAATGTCCCCCAGTCAAAAGATTAGCCTGATTTTCACATATCAGAGTAA
JMSF005H22+ TTTTCACATATCAGAGTAA
                      ____________________________________________________________
consensus CATTAAGTGTGAAATGTCCCCCAGTCAAAAGATTAGCCTGATTTTCACATATCAGAGTAA
 
. : . : . : . : . : . :
JMSF043D07+ AGGGAAAAAGTGCATCTGGGAATACAATCTGCAGTCCAATATTTGGAAACTCTTTATCAT
JMSF025E07+ AGGGAAAAAGTGCATCTGGGAATACAATCTGCAGTCCAATATTTGGAAACTCTTTATCAT
JMSF005H22+ AGGGAAAAAGTGCATCTGGGAATACAATCTGCAGTCCAATATTTGGAAACTCTTTATCAT
                      ____________________________________________________________
consensus AGGGAAAAAGTGCATCTGGGAATACAATCTGCAGTCCAATATTTGGAAACTCTTTATCAT
 
. : . : . : . : . : . :
JMSF043D07+ CATTTAGCTGCATTATCTCTACAACATTTGCCTGACTCTTGTTAATTCTCCAAATTAGAT
JMSF025E07+ CATTTAGCTGCATTATCTCTACAACATTTGCCTGACTCTTGTTAATTCTCCAAATTAGAT
JMSF005H22+ CATTTAGCTGCATTATCTCTACAACATTTGCCTGACTCTTGTTAATTCTCCAAATTAGAT
                      ____________________________________________________________
consensus CATTTAGCTGCATTATCTCTACAACATTTGCCTGACTCTTGTTAATTCTCCAAATTAGAT
 
. : . : . : . : . : . :
JMSF043D07+ AGGTGGGAGGGTTTCCAAATACGGCGTAGGAGGCGGTATCTCTGTTGAGATGGTCCGGCA
JMSF025E07+ AGGTGGGAGGGTTTCCAAATACGGCGTAGGAGGCGGTATCTCTGTTGAGATGGTCCGGCA
JMSF005H22+ AGGTGGGAGGGTTTCCAAATACGGCGTAGGAGGCGGTATCTCTGTTGAGATGGTCCGGCA
                      ____________________________________________________________
consensus AGGTGGGAGGGTTTCCAAATACGGCGTAGGAGGCGGTATCTCTGTTGAGATGGTCCGGCA
 
. : . : . : . : . : . :
JMSF043D07+ GCACGGCGGCGGCCTCGGCCGGAGTAGAAGCAGACGAAGGAACTGATAGCTGAATCCATT
JMSF025E07+ GCACGGCGGCGGCCTCGGCCGGAGTAGAAGCAGACGAAGGAANTGATAGCTGAATCCATT
JMSF005H22+ GCACGGCGGCGGCCTCGGCCGGAGTAGAAGCAGACGAAGGAACTGATAGCTGAATCCATT
                      ____________________________________________________________
consensus GCACGGCGGCGGCCTCGGCCGGAGTAGAAGCAGACGAAGGAACTGATAGCTGAATCCATT
 
. : . : . : . : . : . :
JMSF043D07+ TGATGGCGTCACTGCCGATTATAGGAACTTCCATTCCGGCCAAACACGACCTGCCCCCCA
JMSF025E07+ TGATGGCGTCACTGCCGATTATAGGAACTTCCATTCCGGCCAAACACGACCTGCTCCCCA
JMSF005H22+ TGATGGCGTCACTGCCGATTATAGGAACTTCCATTCCGGCCAAACACGACCTGCTCCCCA
                      ____________________________________________________________
consensus TGATGGCGTCACTGCCGATTATAGGAACTTCCATTCCGGCCAAACACGACCTGCTCCCCA
 
. : . : . : . : . : . :
JMSF043D07+ TTTTCACTCCCCAGAATACAAATCACATTTAGGTTTCAACAGGTTGAGGAAGAAAGAGCC
JMSF025E07+ TTTTCACTCCCCAGAATACAAATCACATTTAGGTTTCAACAGGTTGAGGAAGAAAGAGCC
JMSF005H22+ TTTTCACTCCCCAGAATACAAATCACATTTAGGTTTCAACAGGTTGAGGAAGAAAGAGCC
                      ____________________________________________________________
consensus TTTTCACTCCCCAGAATACAAATCACATTTAGGTTTCAACAGGTTGAGGAAGAAAGAGCC