Previous Contig 004707:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005H17Sequence432004707 (2)gb:AP004084_18374651e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12377012220 (4)gb:AP004888_18466676e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P061
JMSF030H11Sequence658004707 (2)gb:AP004084_18374653e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12778008246 (3)gb:AP004084_18374653e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030H11+ TTCACAAAGCTC
                      ____________________________________________________________
consensus TTCACAAAGCTC
 
. : . : . : . : . : . :
JMSF030H11+ CCCNTCCTCTACAAGTTTGCGCCCATTCACATTTTCCATTGGAACAATCTTAATAACAAG
                      ____________________________________________________________
consensus CCCNTCCTCTACAAGTTTGCGCCCATTCACATTTTCCATTGGAACAATCTTAATAACAAG
 
. : . : . : . : . : . :
JMSF030H11+ TTTGTCCAAAGTATTATTAAGTGTAAGTGGGTATTGCTTTGGTAAGAATTCTTCATCGCT
                      ____________________________________________________________
consensus TTTGTCCAAAGTATTATTAAGTGTAAGTGGGTATTGCTTTGGTAAGAATTCTTCATCGCT
 
. : . : . : . : . : . :
JMSF030H11+ TAAAATAGAAAGAATCCGTAATGCAAGCTCGGTTGTTATGAGCTCCCTCCCATGCTGCCC
                      ____________________________________________________________
consensus TAAAATAGAAAGAATCCGTAATGCAAGCTCGGTTGTTATGAGCTCCCTCCCATGCTGCCC
 
. : . : . : . : . : . :
JMSF030H11+ AAAAGTAAGGAGGATTCTAACTTTTGATCTATCATCGCAGTCTTTCCCACCTTGGCAATA
                      ____________________________________________________________
consensus AAAAGTAAGGAGGATTCTAACTTTTGATCTATCATCGCAGTCTTTCCCACCTTGGCAATA
 
. : . : . : . : . : . :
JMSF030H11+ TGTAACTATAGTTGTATCAGCATGATACCCTCTATTCTTAGTAGAAAGGGTTTCAATAAA
JMSF005H17+ AAA
                      ____________________________________________________________
consensus TGTAACTATAGTTGTATCAGCATGATACCCTCTATTCTTAGTAGAAAGGGTTTCAATAAA
 
. : . : . : . : . : . :
JMSF030H11+ GAGTTTGTCTGGGTGTCGATGCACCAACGACTCAATTTCTTCCAGCAAAGCCCCACTGGT
JMSF005H17+ GAGTTTGTCTGGGTGTCGATGCACCAACGACTCAATTTCTTCCAGCAAAGCCCCACTGGT
                      ____________________________________________________________
consensus GAGTTTGTCTGGGTGTCGATGCACCAACGACTCAATTTCTTCCAGCAAAGCCCCACTGGT
 
. : . : . : . : . : . :
JMSF030H11+ ATGATAAAGATCGCGATTGATGGGCGTCACAGAAGCTTGGCCCTTGGTGGCATTACTTTT
JMSF005H17+ ATGATAAAGATCGCGATTGATGGGCGTCACAGAAGCTTGGCCCTTGGTGGCATTACTTTT
                      ____________________________________________________________
consensus ATGATAAAGATCGCGATTGATGGGCGTCACAGAAGCTTGGCCCTTGGTGGCATTACTTTT
 
. : . : . : . : . : . :
JMSF030H11+ GGCATTGACATTAGAAAAATAAGCAAAGGATGATAATAGGAAGAGAAGAGACAAAAAGGA
JMSF005H17+ GGCATTGACATTAGAAAAATAAGCAAAGGATGATAATAGGAAGAGAAGAGACAAAAAGGA
                      ____________________________________________________________
consensus GGCATTGACATTAGAAAAATAAGCAAAGGATGATAATAGGAAGAGAAGAGACAAAAAGGA
 
. : . : . : . : . : . :
JMSF030H11+ GATCGACGGAGAGGAGAAGAGAGAATAGAGGCGGCGTTGGCGACGGCGGCCCATCTAAAT
JMSF005H17+ GATCGACGGAGAGGAGAAGAGAGAATAGAGGCGGCGTTGGCGACGGCGGCCCATCTAAAT
                      ____________________________________________________________
consensus GATCGACGGAGAGGAGAAGAGAGAATAGAGGCGGCGTTGGCGACGGCGGCCCATCTAAAT
 
. : . : . : . : . : . :
JMSF030H11+ CTGGAGATTGGTGAAGGGAAAGGGAAGAAGAACAAGGACAGCAGCTGTCGTCAGCGTGCT
JMSF005H17+ CTGGAGATTGGTGAAGGGAAAGGGAAGAAGAACAAGGACAGCAGCTGTCGTCAGCGTGCT
                      ____________________________________________________________
consensus CTGGAGATTGGTGAAGGGAAAGGGAAGAAGAACAAGGACAGCAGCTGTCGTCAGCGTGCT
 
. : . : . : . : . : . :
JMSF030H11+ CATTTGAATCAACAGTACAATGTCGTGTCGGGACTCGCAAAATT
JMSF005H17+ CATTTGAATCAACAGTACAATGTCGTGTCGGGACTCGCAAAATTTGAAACAGCAAATGCC
                      ____________________________________________________________
consensus CATTTGAATCAACAGTACAATGTCGTGTCGGGACTCGCAAAATTTGAAACAGCAAATGCC