Previous Contig 004701:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005G11Sequence243004701 (3)510011321 (2)gb:AF492629_18049543e-32Capsicum annuum auxin-induced SAUR-like protein (upa5) mRNA, complete cds.
JMSF021L17Sequence687004701 (3)gb:AC026875_15397369e-26Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I, complete 730013536 (3)gb:AE016959_10231915e-80Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF044E07Sequence798004701 (3)gb:AC026875_15397369e-50Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I, complete 800013536 (3)gb:AE016959_10231913e-87Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044E07+ TACGCATCAAAGACTGAGATGATCGACTT
                      ____________________________________________________________
consensus TACGCATCAAAGACTGAGATGATCGACTT
 
. : . : . : . : . : . :
JMSF044E07+ GCTTTTGCAACAAGGCCTAAATCACCAAGATCCTTATATTGCTTCTTAATGTGTGCTTCT
                      ____________________________________________________________
consensus GCTTTTGCAACAAGGCCTAAATCACCAAGATCCTTATATTGCTTCTTAATGTGTGCTTCT
 
. : . : . : . : . : . :
JMSF044E07+ TTAGCCCCACAAGCCTCGGCAAGGGCCTTAATAATTGATGCATCTCCAATTCCAAGTTCC
                      ____________________________________________________________
consensus TTAGCCCCACAAGCCTCGGCAAGGGCCTTAATAATTGATGCATCTCCAATTCCAAGTTCC
 
. : . : . : . : . : . :
JMSF044E07+ AATCCCTCATGGGCAGGTGCAATTTTGTTTGCAGAAAGGTACACCGCCGGCAACAAGTCG
JMSF021L17+ CAGAAAGGTACACCGCCGGCAACAAGTCG
                      ____________________________________________________________
consensus AATCCCTCATGGGCAGGTGCAATTTTGTTTGCAGAAAGGTACACCGCCGGCAACAAGTCG
 
. : . : . : . : . : . :
JMSF044E07+ TCAGGGGTGGTGTGAATCACGGTCCTTAACATATTGGCCACAATGTCAGTGATGGCAATC
JMSF021L17+ TCAGGGGTGGTGTGAATCACGGTCCTTAACATATTGGCCACAATGTCAGTGATGGCAATC
                      ____________________________________________________________
consensus TCAGGGGTGGTGTGAATCACGGTCCTTAACATATTGGCCACAATGTCAGTGATGGCAATC
 
. : . : . : . : . : . :
JMSF044E07+ CGCCCAGACTCCTCTTCAATTGCACCAAACGCCTTCGCCACAAACATGAACGGCACTCTC
JMSF021L17+ CGCCCAGACTCCTCTTCAATTGCACCAAACGCCTTCGCCACAAACATGAACGGCACTCTC
                      ____________________________________________________________
consensus CGCCCAGACTCCTCTTCAATTGCACCAAACGCCTTCGCCACAAACATGAACGGCACTCTC
 
. : . : . : . : . : . :
JMSF044E07+ TCCCCATCTCCCCAATACGCAGCCTTTTTCGGATCAAAATTCGCCCCCTTCTTCTTCAGC
JMSF021L17+ TCCCCATCTCCCCAATACGCAGCCTTTTTCGGATCAAAATTCGCCCCCTTCTTCTTCAGC
                      ____________________________________________________________
consensus TCCCCATCTCCCCAATACGCAGCCTTTTTCGGATCAAAATTCGCCCCCTTCTTCTTCAGC
 
. : . : . : . : . : . :
JMSF044E07+ TCCGCAACGCTCTCATCAGGACTTATCAACTTCGGTTTCTTAGCTGCCACTTCCTCCCCG
JMSF021L17+ TCCGCAACGCTCTCATCAGGACTTATCAACTTCGGTTTCTTAGCTGCCACTTCCTCCCCG
                      ____________________________________________________________
consensus TCCGCAACGCTCTCATCAGGACTTATCAACTTCGGTTTCTTAGCTGCCACTTCCTCCCCG
 
. : . : . : . : . : . :
JMSF044E07+ CCATTCCTCGCCCCATCTACATTTTCAATCGCCTTCACATTGGAATTGGCATTTTCCGCA
JMSF021L17+ CCATTCCTCGCCCCATCTACATTTTCAATCGCCTTCACATTGGAATTGGCATTTTCCGCA
                      ____________________________________________________________
consensus CCATTCCTCGCCCCATCTACATTTTCAATCGCCTTCACATTGGAATTGGCATTTTCCGCA
 
. : . : . : . : . : . :
JMSF044E07+ ATAGCTGCTGAAACAGAGCTAGACTTCTGCTCCGGAGTGTCTTTTTCGGCGCTCTTGCGT
JMSF021L17+ ATAGCTGCTGAAACAGAGCTAGACTTCTGCTCCGGAGTGTCTTTTTCGGCGCTCTTGCGT
                      ____________________________________________________________
consensus ATAGCTGCTGAAACAGAGCTAGACTTCTGCTCCGGAGTGTCTTTTTCGGCGCTCTTGCGT
 
. : . : . : . : . : . :
JMSF044E07+ TTCTTGGGCGAAGGCTCTTGGGCCGGAGGTGTCTGGGTCTTGGATTTCTTCTTGGAATTG
JMSF021L17+ TTCTTGGGCGAAGGCTCTTGGGCCGGAGGTGTCTGGGTCTTGGATTTCTTCTTGGAATTG
JMSF005G11+ TTG
                      ____________________________________________________________
consensus TTCTTGGGCGAAGGCTCTTGGGCCGGAGGTGTCTGGGTCTTGGATTTCTTCTTGGAATTG
 
. : . : . : . : . : . :
JMSF044E07+ GCCATGAGGACGTCGAACGCTGAGCGAGGAGTGGACATTAGTCTGAGATTAGGGTTTGCG
JMSF021L17+ GCCATGAGGACGTCGAACGCTGAGCGAGGAGTGGACATTGGTCTGAGATTAGGGTTTGCG
JMSF005G11+ GCCATGAGGACGTCGAACGCTGAGCGAGGAGTGGACATTGGTCTGAGATTAGGGTTTGCG
                      ____________________________________________________________
consensus GCCATGAGGACGTCGAACGCTGAGCGAGGAGTGGACATTGGTCTGAGATTAGGGTTTGCG
 
. : . : . : . : . : . :
JMSF044E07+ GAGAAGATTAGGGGTTTAGGAAAGAAGGGTTTAGCGCAGAGGAGAAATGGAATTGAATTG
JMSF021L17+ GAGAAGATTAGGGGTTTAGGAAAGAAGGGTTTAGCGCAGAGGAGAAATGGAATTGAATTG
JMSF005G11+ GAGAAGATTAGGGGTTTAGGAAAGAAGGGTTTAGCGCAGAGGAGAAATGGAATTGAATTG
                      ____________________________________________________________
consensus GAGAAGATTAGGGGTTTAGGAAAGAAGGGTTTAGCGCAGAGGAGAAATGGAATTGAATTG
 
. : . : . : . : . : . :
JMSF044E07+ GGTGTAAGGTGAGAATGGAGGCGAGTGAAGAAGATGAAGGTGTTGGGC
JMSF021L17+ GGTGTAAGGTGAGAATGGAGGCGAGTGAAGAAGATGAAGGTGTTGGGCAAGTAGCAGGAG
JMSF005G11+ GGTGTAAGGTGAGAATGGAGGCGAGTGAAGAAGATGAAGGTGTTGGGCAAGTAGCAGGAG
                      ____________________________________________________________
consensus GGTGTAAGGTGAGAATGGAGGCGAGTGAAGAAGATGAAGGTGTTGGGCAAGTAGCAGGAG
 
. : . : . : . : . : . :
JMSF021L17+ CAAGAACGGAGTGATAACATCAACGGCGGGGGTGCGATTGCGGGGAGGGAATGACAC
JMSF005G11+ CAAGAACGGAGTGATAACATCAACGGCGGGGGTGCGATTGCGGGGAGGGAATGACACACT
                      ____________________________________________________________
consensus CAAGAACGGAGTGATAACATCAACGGCGGGGGTGCGATTGCGGGGAGGGAATGACACACT