Previous Contig 004694:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003G11Sequence544004694 (5)gb:AP002057_18217311e-23Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8.513008271 (4)gb:AP003724_18324572e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049
JMSF005E17Sequence427004694 (5)gb:AP002057_18217317e-21Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8.152001412 (14)
JMSF008E07Sequence321004694 (5)gb:AP002057_18217312e-11Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8.506008271 (4)gb:AP003724_18324573e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049
JMSF011G23Sequence268004694 (5)gb:AP002057_18217311e-07Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8.561008271 (4)gb:AP003724_18324571e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049
JMSF013J11Sequence513004694 (5)gb:AP002057_18217318e-23Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8.655008271 (4)gb:AP003724_18324572e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003G11+ AGGTG
                      ____________________________________________________________
consensus AGGTG
 
. : . : . : . : . : . :
JMFF003G11+ AGTTGGGATCGGAAATTGGAAGAAGGGGCGGCGGCGATGTGGGTTTTCAAGGTTTCGGAG
JMSF013J11+ GCGGCGNCGATGTGGGTTTCCAAGGTTTCGGAG
                      ____________________________________________________________
consensus AGTTGGGATCGGAAATTGGAAGAAGGGGCGGCGGCGATGTGGGTTTTCAAGGTTTCGGAG
 
. : . : . : . : . : . :
JMFF003G11+ AGATGGGTGGCGAGCGAAGGAGGGGCGAGAGAGACTTCTGGGTGGAGAGAATGGGAGAGA
JMSF013J11+ AGATGGGTGNCGAGCGAAGGAGGGGCGAGAGAGACTTCTGGGTGGAGAGAATGGGAGAGA
JMSF005E17+ GGAGAGA
                      ____________________________________________________________
consensus AGATGGGTGGCGAGCGAAGGAGGGGCGAGAGAGACTTCTGGGTGGAGAGAATGGGAGAGA
 
. : . : . : . : . : . :
JMFF003G11+ GAGAGGTGGTGGGAGGGTTGGGTGGTGAACGGAGAGATGACGTGGTAGTGATCGAAGGAG
JMSF013J11+ GAGAGGTGGTGGGAGGGTTGGGTGGTGAACGGAGAGATGACGTGGTAGTGATCGAAGGAG
JMSF005E17+ GAGAGGTGGTGGGAGGNTTGGNTGGTGAACGGAGAGATGACGTGGTAGTGATCGAAGGAG
                      ____________________________________________________________
consensus GAGAGGTGGTGGGAGGGTTGGGTGGTGAACGGAGAGATGACGTGGTAGTGATCGAAGGAG
 
. : . : . : . : . : . :
JMFF003G11+ ACGGNGGAGGAGATGAAGGAGGAGAGAGTGGCGGGAGAGGAGGAGGTGAAGGTGGTCCCC
JMSF013J11+ ACGGCGGAGGAGATGAAGGAGGAGAGAGTGGCGGGAGAGGAGGAGGTGAAGGTGGTCCCC
JMSF008E07+ GAGGAGGTGAAGGTGGTCCCC
JMSF005E17+ ACGGCGGAGGAGATGAAGGAGGAGAGAGTGGCGGGAGAGGAGGAGGTGAAGGTGGTCCCC
                      ____________________________________________________________
consensus ACGGCGGAGGAGATGAAGGAGGAGAGAGTGGCGGGAGAGGAGGAGGTGAAGGTGGTCCCC
 
. : . : . : . : . : . :
JMFF003G11+ ACCAGCTNGACGGTGATTGGGACGGAGACTTGGAGGGAAAGGAGGGCGGCGATGGTGGCC
JMSF013J11+ ACCAGCTTGACGGTGATTGGGACGGAGACTTGGAGGGAAAGGAGGGCGGCGATGGTGGCC
JMSF008E07+ ACCAGCTTGACGGTGATTGGGACGGAGACTTGGAGGGAAAGGAGGGCGGCGATGGTGGCC
JMSF011G23+ GACGGAGACTTGGAGGGAAAGGAGGGCGGCGATGGTGGCC
JMSF005E17+ ACCAGCTTGACGGTGATTGGGACGGAGACTTGGAGGGAAAGGAGGGCGGCGATGGTGGCC
                      ____________________________________________________________
consensus ACCAGCTTGACGGTGATTGGGACGGAGACTTGGAGGGAAAGGAGGGCGGCGATGGTGGCC
 
. : . : . : . : . : . :
JMFF003G11+ GGCTGTTGAGGCGAGGTTTGGGAGAGAGTTTTCTTCAGATAGGAAGGTAGAGAAAGGAAG
JMSF013J11+ GGCTGTTGAGGCGAGGTTTGGGAGAGAGTTTTCTTCAGATAGGAAGGTAGAGAAAGGAAG
JMSF008E07+ GGCTGTTGAGGCGAGGTTTGGGAGAGAGTTTTCTTCAGATAGGAAGGTAGAGAAAGGAAG
JMSF011G23+ GGCTGTTGAGGCGAGGTTTGGGAGAGAGTTTTCTTCAGATAGGAAGGTAGAGAAAGGAAG
JMSF005E17+ GGCTGTTGAGGCGAGGTTTGGGAGAGAGTTTTCTTCAGATAGGAAGGTAGAGAAAGGAAG
                      ____________________________________________________________
consensus GGCTGTTGAGGCGAGGTTTGGGAGAGAGTTTTCTTCAGATAGGAAGGTAGAGAAAGGAAG
 
. : . : . : . : . : . :
JMFF003G11+ GAGTCATTGGTGGCTTGAGGGTCAACCCTGGATTGTTGAGCAAGAAAGGAGTCCAATCCC
JMSF013J11+ GAGTCATTGGTGGCTTGAGGGTCAACCCTGGATTGTTGAGCAAGAAAGGAGTCCAATCCC
JMSF008E07+ GAGTCATTGGTGGCTTGAGGGTCAACCCTGGATTGTTGAGCAAGAAAGGAGTCCAATCCC
JMSF011G23+ GAGTCATTGGTGGCTTGAGGGTCAACCCTGGATTGTTGAGCAAGAAAGGAGTCCAATCCC
JMSF005E17+ GAGTCATTGGTGGCTTGAGGGTCAACCCTGGATTGTTGAGCAAGAAAGGAGTCCAATCCC
                      ____________________________________________________________
consensus GAGTCATTGGTGGCTTGAGGGTCAACCCTGGATTGTTGAGCAAGAAAGGAGTCCAATCCC
 
. : . : . : . : . : . :
JMFF003G11+ AAAATTGGGGCGGAGATGGTGACCGTGGCGGTGGCGAGGAGGCGGAGTAGGAGGAGGAAG
JMSF013J11+ AAAATTGGGGCGGAGATGGTGACCGTGGCGGTGGCGAGGAGGCGGAGTAGGAGGAGGAAG
JMSF008E07+ AAAATTGGGGCGGAGATGGTGACCGTGGCGGTGGCGAGGAGGCGGAGTAGGAGGAGGAAG
JMSF011G23+ AAAATTGGGGCGGAGATGGTGACCGTGGCGGTGGCGAGGAGGCGGAGTAGGAGGAGGAAG
JMSF005E17+ AAAATTGGGGCGGAGATGGTGACCGTGGCGGTGGCGAGGAGGCGGAGTAGGAGGAGGAAG
                      ____________________________________________________________
consensus AAAATTGGGGCGGAGATGGTGACCGTGGCGGTGGCGAGGAGGCGGAGTAGGAGGAGGAAG
 
. : . : . : . : . : . :
JMFF003G11+ ACGACGGTCGGGAGCATTTNTAAGACCTGCGCCGATCCGGTTCAGTTATCGGAGCGAC
JMSF013J11+ ACGACGGTCGGGAGCATTTCTAAGACCTGCGCCGATCCGGTTCAGTTATCGGAGCGAC
JMSF008E07+ ACGACGGTCGGGAGTATTTCTAAGACCTGCGCCGATCCGGTTCAGTTATCGGAGCGAC
JMSF011G23+ ACGACGGTCGGGAGCATTTCTAAGACCTGCGCCGATCCGGTTCAGT
JMSF005E17+ ACGACGGTCGGGAGCATTTCTAAGACCTGCGCCGATCCGGTTCAGTTATCGGAGCGACTC
                      ____________________________________________________________
consensus ACGACGGTCGGGAGCATTTCTAAGACCTGCGCCGATCCGGTTCAGTTATCGGAGCGACTC