Previous Contig 004688:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008D20Sequence555004688 (5)gb:AF118134_17696093e-69Solanum tuberosum hexokinase-related protein 1 (HxkRP1) mRNA, complete cds.583009862 (2)gb:AF118134_17696099e-41Solanum tuberosum hexokinase-related protein 1 (HxkRP1) mRNA, complete cds.
JMFF035G05Sequence539004688 (5)gb:AF118134_17696093e-69Solanum tuberosum hexokinase-related protein 1 (HxkRP1) mRNA, complete cds.255009862 (2)
JMSF005D06Sequence344004688 (5)gb:AF118134_17696092e-28Solanum tuberosum hexokinase-related protein 1 (HxkRP1) mRNA, complete cds.
JMSF009G21Sequence305004688 (5)gb:AF118134_17696093e-21Solanum tuberosum hexokinase-related protein 1 (HxkRP1) mRNA, complete cds.
JMSF017B04Sequence283004688 (5)gb:AF118134_17696095e-17Solanum tuberosum hexokinase-related protein 1 (HxkRP1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035G05+ CGGCAAATGAAAATTTTCACCCTCCTTTTGCGC
JMFF008D20+ CCAGGCGGCAAATGAAAATTTTCACCCTCCTTTTGCGC
                      ____________________________________________________________
consensus CCAGGCGGCAAATGAAAATTTTCACCCTCCTTTTGCGC
 
. : . : . : . : . : . :
JMFF035G05+ AAACTTTGCCAGTGCAGAAGCAATGAAATCAAAAAGTTCCTCGGATGTGCCAAACATCAA
JMFF008D20+ AAACTTTGCCAGTGCAGAAGCAATGAAATCAAAAAGTTCCTCGGATGTGCCAAACATCAA
                      ____________________________________________________________
consensus AAACTTTGCCAGTGCAGAAGCAATGAAATCAAAAAGTTCCTCGGATGTGCCAAACATCAA
 
. : . : . : . : . : . :
JMFF035G05+ TTCTTGTGGTATAGACACTTGCTCAAATTCAGTGGCAACTACACGCTCTTCCTTCCCTCC
JMFF008D20+ TTCTTGTGGTATAGACACTTGCTCAAATTCAGTGGCAACTACACGCTCTTCCTTCCCTCC
                      ____________________________________________________________
consensus TTCTTGTGGTATAGACACTTGCTCAAATTCAGTGGCAACTACACGCTCTTCCTTCCCTCC
 
. : . : . : . : . : . :
JMFF035G05+ CAATTGTACTCTTAGCACGCGGAAATTAGTACCACCGAGGTCCAACGCATAAAACAACCC
JMFF008D20+ CAATTGTACTCTTAGCACGCGGAAATTAGTACCACCGAGGTCCAACGCATAAAACAACCC
                      ____________________________________________________________
consensus CAATTGTACTCTTAGCACGCGGAAATTAGTACCACCGAGGTCCAACGCATAAAACAACCC
 
. : . : . : . : . : . :
JMFF035G05+ CTTCTCATTCCCAGTTGGTAGAGTATCAACATAGCTGAGAATCATTTTCAGATCGCTGCC
JMFF008D20+ CTTCTCATTCCCAGTTGGTAGAGTATCAACATAGCTGAGAATCATTTTCAGATCGCTGCC
JMSF009G21+ CTGCC
JMSF005D06+ GGTAGAGTATCAACATAGCTGAGAATCATTTTCAGATCGCTGCC
                      ____________________________________________________________
consensus CTTCTCATTCCCAGTTGGTAGAGTATCAACATAGCTGAGAATCATTTTCAGATCGCTGCC
 
. : . : . : . : . : . :
JMFF035G05+ GCCATCGACGGCGAGCCCAGCCCGCACATCAGCAGCCATGGCATCTGCCACGTGGCGCAA
JMFF008D20+ GCCATCGACGGCGAGCCCAGCCCGCACATCAGCAGCCATGGCATCTGCCACGTGGCGCAA
JMSF009G21+ GCCATCGACGGCGAGCCCAGCCCGCACATCAGCAGCCATGGCATCTGCCACGTGGCGCAA
JMSF017B04+ CAGCCCGCACATCAGCAGCCATGGCATCTGCCACGTGGCGCAA
JMSF005D06+ GCCATCGACGGCGAGCCCAGCCCGCACATCAGCAGCCATGGCATCTGCCACGTGGCGCAA
                      ____________________________________________________________
consensus GCCATCGACGGCGAGCCCAGCCCGCACATCAGCAGCCATGGCATCTGCCACGTGGCGCAA
 
. : . : . : . : . : . :
JMFF035G05+ GACCGGGAGAGGAGTGGCACAGTCCTTTTCCAGCTTAGTCAAGATCGGAGCTACTCCAAC
JMFF008D20+ GACCGGGAGAGGAGTGGCACAGTCCTTTTCCAGCTTAGTCAAGATCGGAGCTACTCCAAC
JMSF009G21+ GACCGGGAGAGGAGTGGCACAGTCCTTTTCCAGCTTAGTCAAGATCGGAGCTACTCCAAC
JMSF017B04+ GACCGGGAGAGGAGTGGCACAGTCCTTTTCCAGCTTAGTCAAGATCGGAGCTACTCCAAC
JMSF005D06+ GACCGGGAGAGGAGTGGCACAGTCCTTTTCCAGCTTAGTCAAGATCGGAGCTACTCCAAC
                      ____________________________________________________________
consensus GACCGGGAGAGGAGTGGCACAGTCCTTTTCCAGCTTAGTCAAGATCGGAGCTACTCCAAC
 
. : . : . : . : . : . :
JMFF035G05+ GCTTACACCAGATCGGACGGTCATCACCACCCGCGGCCGTGATCTCATCTTGGGTAGCTG
JMFF008D20+ GCTTACACCAGATCGGACGGTCATCACCACCCGCGGCCGTGATCTCATCTTGGGTAGCTG
JMSF009G21+ GCTTACACCAGATCGGACGGTCATCACCACCCGCGGCCGTGATCTCATCTTGGGTAGCTG
JMSF017B04+ GCTTACACCAGATCGGACGGTCATCACCACCCGCGGCCGTGATCTCATCTTGGGTAGCTG
JMSF005D06+ GCTTACACCAGATCGGACGGTCATCACCACCCGCGGCCGTGATCTCATCTTGGGTAGCTG
                      ____________________________________________________________
consensus GCTTACACCAGATCGGACGGTCATCACCACCCGCGGCCGTGATCTCATCTTGGGTAGCTG
 
. : . : . : . : . : . :
JMFF035G05+ CCGCCGGACATGAAAAGATCCGACGATGCTGGCGGCGGCGCAGGCCGACATTTTCGCGTT
JMFF008D20+ CCGCCGGACATGAAAAGATCCGACGATGCTGGCGGCGGCGCAGGCCGACATTTTCGCGTT
JMSF009G21+ CCGCCGGACATGAAAAGATCCGACGATGCTGGCGGCGGCGCAGGCCGACATTTTCGCGTT
JMSF017B04+ CCGCCGGACATGAAAAGATCCGACGATGCTGGCGGCGGCGCAGGCCGACATTTTCGCGTT
JMSF005D06+ CCGCCGGACATGAAAAGATCCGACGATGCTGGCGGCGGCGCAGGCCGACATTTTCGCGTT
                      ____________________________________________________________
consensus CCGCCGGACATGAAAAGATCCGACGATGCTGGCGGCGGCGCAGGCCGACATTTTCGCGTT
 
. : . : . : . : . : . :
JMFF035G05+ GGTCTGTAATAAGATCAATAAACTTT
JMFF008D20+ GGTCTGTAATAAGATCAATAAACTTTGTGACTCACAC
JMSF009G21+ GGTCTGTAATAAGATCAATAAACTTTGTGACTCACACAAAAAAGAAGACTATTAAAAACC
JMSF017B04+ GGTCTGTAATAAGATCAATAAACTTTGTGACTCACACAAAAAAGAAGACTATTAAAAACC
JMSF005D06+ GGTCTGTAATAAGATCAATAAACTTTGTGACTCACACAAAAAAGAAGACTATTAAAAACC
                      ____________________________________________________________
consensus GGTCTGTAATAAGATCAATAAACTTTGTGACTCACACAAAAAAGAAGACTATTAAAAACC