Previous Contig 004685:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005C22Sequence365004685 (3)
JMSF035A19Sequence583004685 (3)gb:AY058198_15643331e-36Arabidopsis thaliana At1g72990/F3N23_19 mRNA, complete cds.>gb:AY142008_1582845 498008878 (5)gb:AC119291_17396861e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052K01, complet
JMSF035D01Sequence701004685 (3)gb:AY058198_15643332e-54Arabidopsis thaliana At1g72990/F3N23_19 mRNA, complete cds.>gb:AY142008_1582845 693008878 (5)gb:AY058198_15643331e-35Arabidopsis thaliana At1g72990/F3N23_19 mRNA, complete cds.>gb:AY142008_1582845

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035D01+ AGCAGGGTCCGATG
                      ____________________________________________________________
consensus AGCAGGGTCCGATG
 
. : . : . : . : . : . :
JMSF035A19+ AAACNTCCCAAATCCC
JMSF035D01+ ATCGAAGTCCAATGGCTGGTTCTATAGCAAGCAACCAAGCTGGAAAACCTCCCAAATCCC
                      ____________________________________________________________
consensus ATCGAAGTCCAATGGCTGGTTCTATAGCAAGCAACCAAGCTGGAAAACCTCCCAAATCCC
 
. : . : . : . : . : . :
JMSF035A19+ ACTCTCCACAGATATATGGTCCAATTNGAAGCATAACTAGTAAATCCAGTTTNTGGCAAA
JMSF035D01+ ACTCTCCACAGATATATGGTCCAATTCGAAGCATAACTAGTAAATCCAGTTTCTGGCAAA
                      ____________________________________________________________
consensus ACTCTCCACAGATATATGGTCCAATTCGAAGCATAACTAGTAAATCCAGTTTCTGGCAAA
 
. : . : . : . : . : . :
JMSF035A19+ GGCTCAAAAATGAAAAGATATCTGCGATTCCTTCAAAAGTCAATTGGCCTGGTCTTGGTT
JMSF035D01+ GGCTCAAAAATGAAAAGATATCTGCGATTCCTTCAAAAGTCAATTGGCCTGGTCTTGGTT
                      ____________________________________________________________
consensus GGCTCAAAAATGAAAAGATATCTGCGATTCCTTCAAAAGTCAATTGGCCTGGTCTTGGTT
 
. : . : . : . : . : . :
JMSF035A19+ CATGTAAATTCCATGCAACATAAGTTTGAATTGTATTCAATCCTAATGCCTTTGCTCTCA
JMSF035D01+ CATGTAAATTCCATGCAACATAAGTTTGAATTGTATTCAATCCTAATGCCTTTGCTCTCA
                      ____________________________________________________________
consensus CATGTAAATTCCATGCAACATAAGTTTGAATTGTATTCAATCCTAATGCCTTTGCTCTCA
 
. : . : . : . : . : . :
JMSF035A19+ ATAATCTATCTTCCCAGTACTCAGGAAGAGTCCGAAAGTAATGCACATCGCCTCCAATTA
JMSF035D01+ ATAATCTATCTTCCCAGTACTCAGGAAGAGTCCGAAAGTAATGCACATCGCCTCCAATTA
                      ____________________________________________________________
consensus ATAATCTATCTTCCCAGTACTCAGGAAGAGTCCGAAAGTAATGCACATCGCCTCCAATTA
 
. : . : . : . : . : . :
JMSF035A19+ TCCGGAAAGGTCTTCCATCTTTCCAGAACATATCATCCGCGATCTCAAATTTCCTGTCGC
JMSF035D01+ TCCGGAAAGGTCTTCCATCTTTCCAGAACATATCATCCGCGATCTCAAATTTCCTGTCGC
JMSF005C22+ GTCGC
                      ____________________________________________________________
consensus TCCGGAAAGGTCTTCCATCTTTCCAGAACATATCATCCGCGATCTCAAATTTCCTGTCGC
 
. : . : . : . : . : . :
JMSF035A19+ CGTCACTGGATTTAGATAGGGAAGACGGAGAGGATATGGAAGGCAGCGGAGCAAACACTG
JMSF035D01+ CGTCACTGGATTTAGATAGGGAAGACGGAGAGGATATGGAAGGCAGCGGAGCAAACACTG
JMSF005C22+ CGTCACTGGATTTAGATAGGGAAGACGGAGAGGATATGGAAGGCAGCGGAGCAAACACTG
                      ____________________________________________________________
consensus CGTCACTGGATTTAGATAGGGAAGACGGAGAGGATATGGAAGGCAGCGGAGCAAACACTG
 
. : . : . : . : . : . :
JMSF035A19+ GCGTGAAAGCTCCAAACGAGAATATAGAAAGCAGGAATATCAGTATCGTGGTTCCGAGCC
JMSF035D01+ GCGTGAAAGCTCCAAACGAGAATATAGAAAGCAGGAATATCAGTATCGTGGTTCCGAGCC
JMSF005C22+ GCGTGAAAGCTCCAAACGAGAATATAGAAAGCAGGAATATCAGTATCGTGGTTCCGAGCC
                      ____________________________________________________________
consensus GCGTGAAAGCTCCAAACGAGAATATAGAAAGCAGGAATATCAGTATCGTGGTTCCGAGCC
 
. : . : . : . : . : . :
JMSF035A19+ GGCGTGTTCTGGCCATTGTTGCCGGTCGAAGTCTGAGCTGCGCCGCCGGAGCTCCGATGC
JMSF035D01+ GGCGTGTTCTGGCCATTGTTGCCGGTCGAAGTCTGAGCTGCGCCGCCGGAGCTCCGATGC
JMSF005C22+ GGCGTGTTCTGGCCATTGTTGCCGGTCGAAGTCTGAGCTGCGCCGCCGGAGCTCCGATGC
                      ____________________________________________________________
consensus GGCGTGTTCTGGCCATTGTTGCCGGTCGAAGTCTGAGCTGCGCCGCCGGAGCTCCGATGC
 
. : . : . : . : . : . :
JMSF035A19+ TCGGAGTAACAGTTTTCTTCAGCGCGGTTCGCATGGAGTGTGGCGCTTCTTCCAGAATTC
JMSF035D01+ TCGGAGTAACAGTTTTCTTCAGCGCGGTTCGCATGGAGTGTGGCGCTTCTTCCAGAATTC
JMSF005C22+ TCGGAGTAACAGTTTTCTTCAGCGCGGTTCGCATGGAGTGTGGCGCTTCTTCCAGAATTC
                      ____________________________________________________________
consensus TCGGAGTAACAGTTTTCTTCAGCGCGGTTCGCATGGAGTGTGGCGCTTCTTCCAGAATTC
 
. : . : . : . : . : . :
JMSF035A19+ AGCTCAACTCCATTTCTGCTCC
JMSF035D01+ AGCTCAACTCCATTTCTGCTCCAAGGAGAGTGAGTAGTGATTAGGAAGTCAACAAGTCCG
JMSF005C22+ AGCTCAACTCCATTTCTGCTCCAAGGAGAGTGAGTAGTGATTAGGAAGTCAACAAGTCCG
                      ____________________________________________________________
consensus AGCTCAACTCCATTTCTGCTCCAAGGAGAGTGAGTAGTGATTAGGAAGTCAACAAGTCCG
 
. : . : . : . : . : . :
JMSF035D01+ GTAATGTTTTCGTTAACAACTTCTT
JMSF005C22+ GTAATGTTTTCGTTAACAACTTCTTTGGCTTCGCACCAATTCAATAATTTCAGAGACTTC
                      ____________________________________________________________
consensus GTAATGTTTTCGTTAACAACTTCTTTGGCTTCGCACCAATTCAATAATTTCAGAGACTTC