Previous Contig 004681:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021J05Sequence504004681 (5)gb:AC117988_17394363e-07Oryza sativa chromosome 3 BAC OSJNBa0057G07 genomic sequence, complete sequence.
JMSF005C09Sequence243004681 (5)126008551 (67)gb:AF039000_17632981e-13Fritillaria agrestis putative serine-glyoxylate aminotransferase (SGA) mRNA, com
JMSF024K03Sequence691004681 (5)gb:AY099787_15768126e-37Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904789013591 (4)gb:AY099787_15768123e-51Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904
JMSF031C02Sequence599004681 (5)gb:AY099787_15768121e-17Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904702013591 (4)gb:AY099787_15768123e-38Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904
JMSF045B16Sequence755004681 (5)gb:AY099787_15768127e-43Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904715013591 (4)gb:AY099787_15768124e-30Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045B16+ TN
                      ____________________________________________________________
consensus TN
 
. : . : . : . : . : . :
JMSF024K03+ CACTTGCATTCCCTTGGC
JMSF045B16+ TGATATTAGAAGATCCATGGTCTCTTTACCCAGTTGCTCAAGCACTTGCATTCCCTTGGC
                      ____________________________________________________________
consensus TGATATTAGAAGATCCATGGTCTCTTTACCCAGTTGCTCAAGCACTTGCATTCCCTTGGC
 
. : . : . : . : . : . :
JMSF024K03+ AGTAAAAGCTTTTCCTGTCTCCAGAATGGATGGCGCACCAGAACCAGTTTCCCCAGGTAA
JMSF045B16+ AGTAAAAGCTTTTCCTGTCTCCAGAATGGATGGCGCACCAGAACCAGTTTCCCCAGGTAA
                      ____________________________________________________________
consensus AGTAAAAGCTTTTCCTGTCTCCAGAATGGATGGCGCACCAGAACCAGTTTCCCCAGGTAA
 
. : . : . : . : . : . :
JMSF024K03+ GCCACCTTGCTGAATGGATTCCTCAAGCTTGTGAACAAAACTAGAACCCCCTTTCAATGC
JMSF031C02+ TGAACAAAACTAGAACCCCCTTTCAATGC
JMSF045B16+ GCCACCTTGCTGAATGGATTCCTCAAGCTTGTGAACAAAACTAGAACCCCCTTTCAATGC
                      ____________________________________________________________
consensus GCCACCTTGCTGAATGGATTCCTCAAGCTTGTGAACAAAACTAGAACCCCCTTTCAATGC
 
. : . : . : . : . : . :
JMSF024K03+ ATTTCCTAGTGCTTGCCAAGCCCCTGAAGCAATACTCTCAACTGAATTGTCAATGACCTT
JMSF031C02+ ATTTCNTAGTGCTTGCCAAGCCCCTGAAGCAATACTCTCAANTGAATTGTCAATGACCTT
JMSF045B16+ ATTTCCTAGTGCTTGCCAAGCCCCTGAAGCAATACTCTCAACTGAATTGTCAATGACCTT
                      ____________________________________________________________
consensus ATTTCCTAGTGCTTGCCAAGCCCCTGAAGCAATACTCTCAACTGAATTGTCAATGACCTT
 
. : . : . : . : . : . :
JMSF024K03+ CAAGCCCTGGCCAAGGAAAGAATCTTCACTAGCTTTCTCTAATTTATCCAAAGCCTCCTT
JMSF031C02+ CAAGCCCTGGCCAAGGAAAGAATCTTCACTAGCTTTCTNTAATTTATCCAAAGCCTCCNT
JMFF021J05+ TGGCCAAGGAAAGAATCTTCACTAGCTTTCTCTAATTTATCCAAAGCCTCCTT
JMSF045B16+ CAAGCCCTGGCCAAGGAAAGAATCTTCACTAGCTTTCTCTAATTTATCCAAAGCCTCCTT
                      ____________________________________________________________
consensus CAAGCCCTGGCCAAGGAAAGAATCTTCACTAGCTTTCTCTAATTTATCCAAAGCCTCCTT
 
. : . : . : . : . : . :
JMSF024K03+ GCGTCGTTTGTCATTCTCATCTTCACCTTCAATCTCAACTGCAGATGCTTCAGTTTCATT
JMSF031C02+ GCGTCGTTTGTCATTCTCATCTTCACCTTCAATCTCAACTGCAGATGCTTCAGTTTCATT
JMFF021J05+ GCGTCGTTTGTCATTCTCACCTTCACCTTCAATCTCAACTGCAGATGCTTCAGTTTCATT
JMSF045B16+ GCGTCGTTTGTCATTCTCATCTTCACCTTCAATCTCAACTGCAGATGCTTCAGTTTCATT
                      ____________________________________________________________
consensus GCGTCGTTTGTCATTCTCATCTTCACCTTCAATCTCAACTGCAGATGCTTCAGTTTCATT
 
. : . : . : . : . : . :
JMSF024K03+ CTCGTTAGCAGATTCAGACTCCTCAACTGCATTCTGCACGTCAGAAATGCTTTTTGCTGC
JMSF031C02+ CTCGTTAGCAGATTCAGACTCCTCAANTGCATTCTGCACGTCAGAAATGCTTTTTGCTGC
JMFF021J05+ CTCGTTAGCAGATTCAGACTCCTCAACTGCATTCTGCACGTCAGAAATGCTTTTTGCTGC
JMSF045B16+ CTCGTTAGCAGATTCAGACTCCTCAACTGCATTCTGCACGTCAGAAATGCTTTTTGCTGC
                      ____________________________________________________________
consensus CTCGTTAGCAGATTCAGACTCCTCAACTGCATTCTGCACGTCAGAAATGCTTTTTGCTGC
 
. : . : . : . : . : . :
JMSF024K03+ TGTTTTAGCAGCCTCAACAGCATTGCGAGAGATCTCTTCGGCAGCAACGGTGGCAACCTT
JMSF031C02+ TGTTTTAGCAGCCTCAACAGCATTGCGAGAGATCTCTTCGGCAGCAACGGTGGCAACCTT
JMFF021J05+ TGTTTTAGCAGCCTCAACAGCATTGCGAGAGATCTCTTCGGCAGCAACGGTGGCAACCTT
JMSF045B16+ TGTTTTAGCAGCCTCAACAGCATTGCGAGAGATCTCTTCGGCAGCAACGGTGGCAACCTT
                      ____________________________________________________________
consensus TGTTTTAGCAGCCTCAACAGCATTGCGAGAGATCTCTTCGGCAGCAACGGTGGCAACCTT
 
. : . : . : . : . : . :
JMSF024K03+ CTGAAGGTCGGAGAGATAAGAGAAAGCGGAGAACCCCCACCCACCCCATCCACCGCCAGC
JMSF031C02+ NTGAAGGTCGGAGAGATAAGAGAAAGCGGAGAACCCCCACCCACCCCATCCACCGCCAGC
JMFF021J05+ CTGAAGGTCGGAGAGATAAGAGAAAGCGG-GAACCACCACCCACCCCATCCACCGCCAGC
JMSF045B16+ CTGAAGGTCGGAGAGATAAGAGAAAGCGGAGAACCCCCACCCACCCCATCCACCGCCAGC
                      ____________________________________________________________
consensus CTGAAGGTCGGAGAGATAAGAGAAAGCGGAGAACCCCCACCCACCCCATCCACCGCCAGC
 
. : . : . : . : . : . :
JMSF024K03+ ACGGCTGCTATCCTGCGCAGGTGTTCCTTTTGGCGCTTCAGTTGCCGTTGTCGTCGCCTC
JMSF031C02+ ACGGCTGCTATCCTGCGCAGGTGTTCCTTTTGGCGCTTCAGTTGCCGTTGTCGTCGCCTC
JMFF021J05+ ACGGCTGCTATCCTGCGCAGGTGTTCCTTTTGGCGCTTCAGTTGCCGTTGTCGTCGCCTC
JMSF045B16+ ACGGCTGCTATCCTGCGCAGATGTTCCTTTTGGCGCTTCAGTTGCCGTTGTCGTCGCCTC
JMSF005C09+ CTC
                      ____________________________________________________________
consensus ACGGCTGCTATCCTGCGCAGGTGTTCCTTTTGGCGCTTCAGTTGCCGTTGTCGTCGCCTC
 
. : . : . : . : . : . :
JMSF024K03+ CGTTACTCCTTCACCTTCCTGTACAAGTTTTATCTCTTCTTCATTCGAAGATTTGGCCGT
JMSF031C02+ CGTTACTCCTTCACCTTCCTGTACAAGTTTTATCTCTTCTTCATTCGAAGATTTGGCCGT
JMFF021J05+ CGTTACTCCTTCACCTTCCTGTACAAGTTTTATCTCTTCTTCATTCGAAGATTTGGCCGT
JMSF045B16+ CGTTACTCCTTCACCTTCCTGTACAAGTTTTATCTCTTCTTCATTCGAAGATTTGGCCGT
JMSF005C09+ CGTTACTCCTTCACCTTCCTGTACAAGTTTTATCTCTTCTTCATTCGAAGATTTGGCCGT
                      ____________________________________________________________
consensus CGTTACTCCTTCACCTTCCTGTACAAGTTTTATCTCTTCTTCATTCGAAGATTTGGCCGT
 
. : . : . : . : . : . :
JMSF024K03+ TATCTCCGCCATTTTAGTTCCGAGCGTTCAGTTACTGGTCAGAATCCCGCCGAGGAACAA
JMSF031C02+ TATCTCCGCCATTTTAGTTCCGAGCGTTCAGTTACTGGTCAGAATCCCGCCGAGGAACAA
JMFF021J05+ TATCTCCGCCATTTTAGTTCCGAGCGTTCAGTTACTGGTCAGAATCCCGCCGAGGAACAA
JMSF045B16+ TATCTCCGCCATTTTAGTTCCGAGCGTTCAGTTACTGGTCAGAATCCCGCCGAGGAACAA
JMSF005C09+ TATCTCCGCCATTTTAGTTCCGAGCGTTCAGTTACTGGTCAGAATCCCGCCGAGGAACAA
                      ____________________________________________________________
consensus TATCTCCGCCATTTTAGTTCCGAGCGTTCAGTTACTGGTCAGAATCCCGCCGAGGAACAA
 
. : . : . : . : . : . :
JMSF024K03+ CAGATCGCCC
JMSF031C02+ CAGATCGCCCTGCTTCTCGGTGAAGATCC
JMFF021J05+ CAGATCGCCCTGCTTCTCGGTGAAGATCC
JMSF045B16+ CAGATCGCCCTGCTTCTCGGTGAAGATCC
JMSF005C09+ CAGATCGCCCTGCTTCTCGGTGAAGATCCAATGCCACCTCAAATTCAGTGGTTGGGTTTA
                      ____________________________________________________________
consensus CAGATCGCCCTGCTTCTCGGTGAAGATCCAATGCCACCTCAAATTCAGTGGTTGGGTTTA
 
. : . : . : . : . : . :
JMSF005C09+ CCTACCGATCTGGTAAGACTTGTCCTTGACGGCAAAAGGATTCGAAACGAAACGACGTCC
                      ____________________________________________________________
consensus CCTACCGATCTGGTAAGACTTGTCCTTGACGGCAAAAGGATTCGAAACGAAACGACGTCC