Previous Contig 004680:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038F24Sequence550004680 (10)gb:AY059120_15644849e-71Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228743004680 (10)gb:AY059120_15644848e-50Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228
JMFN012N19Sequence627004680 (10)gb:AY059120_15644842e-39Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228
JMFN019K15Sequence625004680 (10)gb:AY059120_15644845e-71Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228
JMFS022H06Sequence612004680 (10)gb:AY059120_15644842e-73Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228
JMSF005C05Sequence344004680 (10)gb:AY059120_15644842e-32Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228434004680 (10)gb:AY059120_15644847e-13Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228
JMSF006C05Sequence340004680 (10)gb:AY059120_15644841e-31Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228
JMSF010M15Sequence253004680 (10)gb:AY059120_15644843e-17Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228746004680 (10)gb:AY059120_15644842e-55Arabidopsis thaliana unknown protein (At1g03110) mRNA, complete cds.>gb:AF370228

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012N19+ ACAA
rJMFF038F24- TGAAGCAAAACCAAGGTAATAAAACACTGTTCCAACTAGTTTTTACAACAA
                      ____________________________________________________________
consensus TGAAGCAAAACCAAGGTAATAAAACACTGTTCCAACTAGTTTTTACAACAA
 
. : . : . : . : . : . :
rJMSF005C05- TTATCATCAGAAGACAATGCCAAATTGCANAATCNGCAGCCTTCCATCTTTATAGAACAA
JMFN012N19+ TTATCATCAGAAGACAATGCCAAATTGCAAAATCAGCAGCCTTCCATCTTTATAGAACAA
rJMFF038F24- TTATCATCAGAAGACAATGCCAAATTGCAAAATCAGCAGCCTTCCATCTTTATAGAACAA
rJMSF010M15- TTATCATCAGAAGACAATGCCAAATTGCAAAATCAGCAGCCTTCCATCTTTATAGAACAA
                      ____________________________________________________________
consensus TTATCATCAGAAGACAATGCCAAATTGCAAAATCAGCAGCCTTCCATCTTTATAGAACAA
 
. : . : . : . : . : . :
rJMSF005C05- GAAATAATATTATCTACTTTTTCTTGTCGGTCCTGCCTCGCTTTCTGAATTCCCGTCTCT
JMFN012N19+ GAAATAATATTATCTACTTTTTCTTGTCGTTCCTGCCTCGCTTTCTGAATTCCCGTCTCT
rJMFF038F24- GAAATAATATTATCTACTTTTTCTTGTCGTTCCTGCCTCGCTTTCTGAATTCCCGTCTCT
rJMSF010M15- GAAATAATATTATCTACTTTTTCTTGTCGTTCCTGCCTCGCTTTCTGAATTCCCGTCTCT
                      ____________________________________________________________
consensus GAAATAATATTATCTACTTTTTCTTGTCGTTCCTGCCTCGCTTTCTGAATTCCCGTCTCT
 
. : . : . : . : . : . :
rJMSF005C05- CTGAAGAGTACTGCTTCTTGATCAAGAGATTTCGCATTGCTGTCTTGACTGCTTCAGCGG
JMFN012N19+ CTGAAGAGTACTGCTTCTTGATCAAGAGATTTCGCATTGCTGTCTTGACTGCTTCAGCGG
rJMFF038F24- CTGAAGAGTACTGCTTCTTGATCAAGAGATTTCGCATTGCTGTCTTGACTGCTTCAGCGG
rJMSF010M15- CTGAAGAGTACTGCTTCTTGATCAAGAGATTTCGCATTGCTGTCTTGACTGCTTCAGCGG
                      ____________________________________________________________
consensus CTGAAGAGTACTGCTTCTTGATCAAGAGATTTCGCATTGCTGTCTTGACTGCTTCAGCGG
 
. : . : . : . : . : . :
rJMSF005C05- CTGTTAAGAAGACTTCGGTTTTTATACACAAATCTCCTTGCNATTTCTGGAGCATTGCTT
JMFN012N19+ CTGTTAAGAAGACTTCGGTTTTTATACACAAATCTCCTTGCAATTTCTGGAGCATTGCTT
rJMFF038F24- CTGTTAAGAAGACTTCGGTTTTTATACACAAATCTCCTTGCAATTTCTGGAGCATTGCTT
rJMSF010M15- CTGTTAAGAAGACTTCGGTTTTTATACACAAATCTCCTTGCAATTTCTGGAGCATTGCTT
                      ____________________________________________________________
consensus CTGTTAAGAAGACTTCGGTTTTTATACACAAATCTCCTTGCAATTTCTGGAGCATTGCTT
 
. : . : . : . : . : . :
rJMSF005C05- CTCCCCCCGGTACGTCTTTATCTTCTAAAAAAGATGGTTCTTGATCGGTAGAGCCTTGGT
JMFN012N19+ CTCCCCCCGGTACGTCTTTATCTTCTAAAAAAGATGGTTCTTGATCGGTAGAGCCTTGGT
rJMFF038F24- CTCCCCCCGGTACGTCTTTATCTTCTAAAAAAGATGGTTCTTGATCGGTAGAGCCTTGGT
rJMSF010M15- CTCCCCCCGGTACGTCTTTATCTTCTAAAAAAGATGGTTCTTGATCGGTAGAGCCTTGGT
                      ____________________________________________________________
consensus CTCCCCCCGGTACGTCTTTATCTTCTAAAAAAGATGGTTCTTGATCGGTAGAGCCTTGGT
 
. : . : . : . : . : . :
rJMSF005C05- TGGTCTTCCCGAAACCAGAGAGGACCCTCACGCGTGTC-AAGATCCTGATTCCGAANCAT
JMFN012N19+ TGGTCTTCCCGAAACCAGAGAGGACCCTCACGCGTGCCAAAGATCCTGATTCCGAAGCAT
rJMFF038F24- TGGTCTTCCCGAAACCAGAGAGGACCCTCACGCGTGCCAAAGATCCTGATTCCGAAGCAT
rJMSF010M15- TGGTCTTCCCGAAACCAGAGAGGACCCTCACGCGTGCCAAAGATCCTGATTCCGAAGCAT
JMFN019K15+ GGACCCTCACGCGTGCCAAAGATCCTGATTCCGAAGCAT
                      ____________________________________________________________
consensus TGGTCTTCCCGAAACCAGAGAGGACCCTCACGCGTGCCAAAGATCCTGATTCCGAAGCAT
 
. : . : . : . : . : . :
rJMSF005C05- TNAAACTCGAGACANCCATGACCAGCCATAATAACCCTGCTGAGGTAGCTCCCGCTCC
JMFN012N19+ TTAAACTCGAGACACCCATGACCAGCCATAATAACCCTGCTGAGGTAGCTCCCGCTCCCA
rJMFF038F24- TTAAACTCGAGACACCCATGACCAGCCATAATAACCCTGCTGAGGTAGCTCCCGCTCCCA
rJMSF010M15- TTAAACTCGAGACACCCATGACCAGCCATAATAACCCTGCTGAGGTAGCTCCCGCTCCCA
JMFN019K15+ TTAAACTCGAGACACCCATGACCAGCCATAATAACCCTGCTGAGGTAGCTCCCGCTCCCA
                      ____________________________________________________________
consensus TTAAACTCGAGACACCCATGACCAGCCATAATAACCCTGCTGAGGTAGCTCCCGCTCCCA
 
. : . : . : . : . : . :
JMFN012N19+ AGCTCGTGGGAATGAAAGTCTCCCCATCAATTCGCACCACTTTGAAAACAGAGAGACTTT
rJMFF038F24- AGCTCGTGGGAATGAAAGTCTCCCCATCAATTCGCACCACTTTGAAAACAGAGAGACTTT
rJMSF010M15- AGCTCGTGGGAATGAAAGTCTCCCCATCAATTCGCACCACTTTGAAAACAGAGAGACTTT
JMFN019K15+ AGCTCGTGGGAATGAAAGTCTCCCCATCAATTCGCACCACTTTGAAAACAGAGAGACTTT
                      ____________________________________________________________
consensus AGCTCGTGGGAATGAAAGTCTCCCCATCAATTCGCACCACTTTGAAAACAGAGAGACTTT
 
. : . : . : . : . : . :
JMFN012N19+ TCGTTGAAAGGTCACAGCTCAACAACATCACTCCCGGTAAGCTCTGAATGGCCACTGCAA
rJMFF038F24- TCGTTGAAAGGTCACAGCTCAACAACATCACTCCCGGTAAGCTCTGAATGGCCACTGCAA
rJMSF010M15- TCGTTGAAAGGTCACAGCTCAACAACATCACTCCCGGTAAGCTCTGAATGGCCACTGCAA
JMFN019K15+ TCGTTGAAAGGTCACAGCTCAACAACATCACTCCCGGTAAGCTCTGAATGGCCACTGCAA
                      ____________________________________________________________
consensus TCGTTGAAAGGTCACAGCTCAACAACATCACTCCCGGTAAGCTCTGAATGGCCACTGCAA
 
. : . : . : . : . : . :
JMFN012N19+ CTAGAGATCCATCAGGCGTCGCACAGAGATCAGTGACAGCAGGAATAATATCTTCTTCGC
rJMFF038F24- CTAGAGATCCATCAGGCGTCGCACAGAGATCAGTGACAGCAGGAATAATATCTTCTTCGC
rJMSF010M15- CTAGAGATCCATCAGGCGTCGCACAGAGATCAGTGACAGCAGGAATAATATCTTCTTCGC
JMFN019K15+ CTAGAGATCCATCAGGCGTCGCACAGAGATCAGTGACAGCAGGAATAATATCTTCTTCGC
                      ____________________________________________________________
consensus CTAGAGATCCATCAGGCGTCGCACAGAGATCAGTGACAGCAGGAATAATATCTTCTTCGC
 
. : . : . : . : . : . :
JMFN012N19+ CGCCATTTGACTCT
rJMFF038F24- CGCCATTTGACTCTGCAACTCCTGCCAATGATCCAACATGGCATGTGTCTAGAAGAGAAC
rJMSF010M15- CGCCATTTGACTCTGCAACTCCTGCCAATGATCCAACATGGCATGTGTCTAGAAGAGAAC
JMFN019K15+ CGCCATTTGACTCTGCAACTCCTGCCAATGATCCAACATGGCATGTGTCTAGAAGAGAAC
JMFF038F24+ CGCCATTTGACTCTGCAACTCCTGCCAATGATCCAACATGGCATGTGTCTAGAAGAGAAC
                      ____________________________________________________________
consensus CGCCATTTGACTCTGCAACTCCTGCCAATGATCCAACATGGCATGTGTCTAGAAGAGAAC
 
. : . : . : . : . : . :
rJMFF038F24- CACAAGCATAGTCCCATAAGCGAATAGTTGAA
rJMSF010M15- CACAAGCATAGTCCCATAAGCGAATAGTTGAATCACCACCTCCCGAGACTAGAAAACCCT
JMFN019K15+ CACAAGCATAGTCCCATAAGCGAATAGTTGAATCACCACCTCCCGAGACTAGAAAACCCT
JMFF038F24+ CACAAGCATAGTCCCATAAGCGAATAGTTGAATCACCACCTCCCGAGACTAGAAAACCCT
                      ____________________________________________________________
consensus CACAAGCATAGTCCCATAAGCGAATAGTTGAATCACCACCTCCCGAGACTAGAAAACCCT
 
. : . : . : . : . : . :
rJMSF010M15- GTGGAAAATCCGGAT
JMFN019K15+ GTGGAAAATCCGGATTGCAAACAAAGGCAAGGCAGGTGACAAACTCGGTATGGCCGAGAC
JMFF038F24+ GTGGAAAATCCGGATTGCAAACAAAGGCAAGGCAGGTGACAAACTCGGTATGGCCGAGAC
JMFS022H06+ CCGGATTGCAAACAAAGGCAAGGCAGGTGACAAACTCGGTATGGCCGAGAC
                      ____________________________________________________________
consensus GTGGAAAATCCGGATTGCAAACAAAGGCAAGGCAGGTGACAAACTCGGTATGGCCGAGAC
 
. : . : . : . : . : . :
JMFN019K15+ AAAAGCTCTGAATCTCATGAGCTCCATTCAACGGGTTTTGGGGAAAGAGAGTAACTCGGA
JMFF038F24+ AAAAGCTCTGAATCTCATGAGCTCCATTCAACGGGTTTTGGGGAAAGAGAGTAACTCGGA
JMFS022H06+ AAAAGCTCTGAATCTCATGAGCTCCATTCAACGGGTTTTGGGGAAAGAGAGTAACTCGGA
                      ____________________________________________________________
consensus AAAAGCTCTGAATCTCATGAGCTCCATTCAACGGGTTTTGGGGAAAGAGAGTAACTCGGA
 
. : . : . : . : . : . :
JMFN019K15+ TTTTGAAGTCCCGATCAGCACTAATGATAAATCGCCCATCTGGTGAAAACTCCAGGCTAG
JMFF038F24+ TTTTGAAGTCCCGATCAGCACTAATGATAAATCGCCCATCTGGTGAAAACTCCAGGCTAG
JMFS022H06+ TTTTGAAGTCCCGATCAGCACTAATGATAAATCGCCCATCTGGTGAAAACTCCAGGCTAG
                      ____________________________________________________________
consensus TTTTGAAGTCCCGATCAGCACTAATGATAAATCGCCCATCTGGTGAAAACTCCAGGCTAG
 
. : . : . : . : . : . :
JMFN019K15+ TAATGATGCTGCAATAGTGGGAAAGAATTGGAACTGCCTTCTTATT
JMFF038F24+ TAATGATGCTGCAATAGTGGGAAAGAATTGGAACTGCCTTCTTATTGGGAATATCTTGCT
JMFS022H06+ TAATGATGCTGCAATAGTGGGAAAGAATTGGAACTGCCTTCTTATTGGGAATATCTTGCT
                      ____________________________________________________________
consensus TAATGATGCTGCAATAGTGGGAAAGAATTGGAACTGCCTTCTTATTGGGAATATCTTGCT
 
. : . : . : . : . : . :
JMFF038F24+ TTTCAGAACTCTCTATATCGGTTATATATACCATCCCAAATTTGTCTGCAAAGCACACAA
JMFS022H06+ TTTCAGAACTCTCTATATCGGTTATATATACCATCCCAAATTTGTCTGCAAAGCACACAA
                      ____________________________________________________________
consensus TTTCAGAACTCTCTATATCGGTTATATATACCATCCCAAATTTGTCTGCAAAGCACACAA
 
. : . : . : . : . : . :
JMFF038F24+ AGCGACCATTCTTGCTTATAGCAACAGCACTAACTCTTTTCTCCGATAAAACAGAATGTG
JMFS022H06+ AGCGACCATTCTTGCTTATAGCAACAGCACTAACTCTTTTCTCCGATAAAACAGAATGTG
JMSF006C05+ GCAACAGCACTAACTCTTTTCTCCGATAAAACAGAATGTG
JMSF005C05+ GCAACAGCACTAACTCTTTTCTCCGATAAAACAGAATGTG
                      ____________________________________________________________
consensus AGCGACCATTCTTGCTTATAGCAACAGCACTAACTCTTTTCTCCGATAAAACAGAATGTG
 
. : . : . : . : . : . :
JMFF038F24+ TACAACGCCAAGAATCAGTGACCCAAATCTTAACAAGCTTGTCATCCCCTGCAGATACGA
JMFS022H06+ TACAACGCCAAGAATCAGTGACCCAAATCTTAACAAGCTTGTCATCCCCTGCAGATACGA
JMSF006C05+ TACAACGCCAAGAATCAGTGACCCAAATCTTAACAAGCTTGTCATCCCCTGCAGATACGA
JMSF010M15+ CCTGCAGATACGA
JMSF005C05+ TACAACGCCAAGAATCAGTGACCCAAATCTTAACAAGCTTGTCATCCCCTGCAGATACGA
                      ____________________________________________________________
consensus TACAACGCCAAGAATCAGTGACCCAAATCTTAACAAGCTTGTCATCCCCTGCAGATACGA
 
. : . : . : . : . : . :
JMFF038F24+ ATAGCTTCCC
JMFS022H06+ ATAGCTTCCCTTCTGCTCCATATCGGATCGCTCTAATTGAATCCTTATGCTTGTTTCCTC
JMSF006C05+ ATAGCTTCCCTTCTGCTCCATATCGGATCGCTCTAATTGAATCCTTATGCTTGTTTCCTC
JMSF010M15+ ATAGCTTCCCTTCTGCTCCATATCGGATCGCTCTAATTGAATCCTTATGCTTGTTTCCTC
JMSF005C05+ ATAGCTTCCCTTCTGCTCCATATCGGATCGCTCTAATTGAATCCTTATGCTTGTTTCCTC
                      ____________________________________________________________
consensus ATAGCTTCCCTTCTGCTCCATATCGGATCGCTCTAATTGAATCCTTATGCTTGTTTCCTC
 
. : . : . : . : . : . :
JMFS022H06+ CAGACTCATCCAGCAACGATACTGAATGACCTCGAAGATTGAAGACGCGGAGGTCCGAGC
JMSF006C05+ CAGACTCATCCAGCAACGATACTGAATGACCTCGAAGATTGAAGACGCGGAGGTCCGAGC
JMSF010M15+ CAGACTCATCCAGCAACGATACTGAATGACCTCGAAGATTGAAGACGCGGAGGTCCGAGC
JMSF005C05+ CAGACTCATCCAGCAACGATACTGAATGACCTCGAAGATTGAAGACGCGGAGGTCCGAGC
                      ____________________________________________________________
consensus CAGACTCATCCAGCAACGATACTGAATGACCTCGAAGATTGAAGACGCGGAGGTCCGAGC
 
. : . : . : . : . : . :
JMFS022H06+ CAACAGCGACGGCAACCGATTCTTGGGTCGGATGAACTGCAATTAGTGCCGGAGCAGCCT
JMSF006C05+ CAACAGCGACGGCAACCGATTCTTGGGTCGGATGAACTGCAATTAGTGCCGGAGCAGCCT
JMSF010M15+ CAACAGCGACGGCAACCGATTCTTGGGTCGGATGAACTGCAATTAGTGCCGGAGCAGCCT
JMSF005C05+ CAACAGCGACGGCAACCGATTCTTGGGTCGGATGAACTGCAATTAGTGCCGGAGCAGCCT
                      ____________________________________________________________
consensus CAACAGCGACGGCAACCGATTCTTGGGTCGGATGAACTGCAATTAGTGCCGGAGCAGCCT
 
. : . : . : . : . : . :
JMFS022H06+ CCGTTTCCCGGTTCTGCTCGT
JMSF006C05+ CCGTTTCCCGGTTCTGCTCGTTATCATCCATGTTGGTTTCCTCCATTCCTTTGCAGA
JMSF010M15+ CCGTTTCCCGGTTCTGCTCGTTATCATCCATGTTGGTTTCCTCCATTCCTTTGCAGA
JMSF005C05+ CCGTTTCCCGGTTCTGCTCGTTATCATCCATGTTGGTTTCCTCCATTCCTTTGCAGAGCC
                      ____________________________________________________________
consensus CCGTTTCCCGGTTCTGCTCGTTATCATCCATGTTGGTTTCCTCCATTCCTTTGCAGAGCC