Previous Contig 004679:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS076B07Sequence615004679 (3)
JMSF005C02Sequence324004679 (3)
JMSF039A22Sequence670004679 (3)gb:AC132492_17412072e-16Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete seq850023836gb:AC132492_17412072e-08Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039A22+ TGAGACATAT
                      ____________________________________________________________
consensus TGAGACATAT
 
. : . : . : . : . : . :
JMSF039A22+ CAAAGTCANCCACAGATGTTGAGCCATTCGCAACTTCCTCAGAATTTAACGGTCTACATC
                      ____________________________________________________________
consensus CAAAGTCANCCACAGATGTTGAGCCATTCGCAACTTCCTCAGAATTTAACGGTCTACATC
 
. : . : . : . : . : . :
JMSF039A22+ TACAGAAAACCCGAATGTTGCCTTTCAACTCAATTACTTCATTGTAGAGCCGCTTCCTCT
                      ____________________________________________________________
consensus TACAGAAAACCCGAATGTTGCCTTTCAACTCAATTACTTCATTGTAGAGCCGCTTCCTCT
 
. : . : . : . : . : . :
JMSF039A22+ CTGAGCACTCATCAAGATATCTTTTCTTCAAAACAGCACACTCTTCGTCATATTTCGTCC
                      ____________________________________________________________
consensus CTGAGCACTCATCAAGATATCTTTTCTTCAAAACAGCACACTCTTCGTCATATTTCGTCC
 
. : . : . : . : . : . :
JMFS076B07+ ACTAAGATCCTTAAGAGCGCAGAAAACTTCAGGACAAGGAA
JMSF039A22+ TAAGAAGTTCATGTTGCACACTAAGATCCTTAAGAGCGCAGAAAACTTCAGGACAAGGAA
                      ____________________________________________________________
consensus TAAGAAGTTCATGTTGCACACTAAGATCCTTAAGAGCGCAGAAAACTTCAGGACAAGGAA
 
. : . : . : . : . : . :
JMFS076B07+ AAGAATCTCCAGTGATACCCTTCACTTCATCACTTAAAGCTGCATGTTCTTTTCTCAATT
JMSF039A22+ AAGAATCTCCAGTGATACCCTTCACTTCATCACTTAAAGCTGCATGTTCTTTTCTCAATT
                      ____________________________________________________________
consensus AAGAATCTCCAGTGATACCCTTCACTTCATCACTTAAAGCTGCATGTTCTTTTCTCAATT
 
. : . : . : . : . : . :
JMFS076B07+ CATGTACTTTAGTGGACAGGTCTTCAATTTTCTGAAAAATAGGAAGAGTTTGTTCTTGGT
JMSF039A22+ CATGTACTTTAGTGGACAGGTCTTCAATTTTCTGAAAAATAGGAAGAGTTTGTTCTTGGT
JMSF005C02+ AAATAGGAAGAGTTTGTTCTTGGT
                      ____________________________________________________________
consensus CATGTACTTTAGTGGACAGGTCTTCAATTTTCTGAAAAATAGGAAGAGTTTGTTCTTGGT
 
. : . : . : . : . : . :
JMFS076B07+ ATGAAATTTCTGGGGTGTCACTTGAAACAATACTCTCATCCCCCAAATCAGTGCTCACTT
JMSF039A22+ ATGAAATTTCTGGGGTGTCACTTGAAACAATACTCTCATCCCCCAAATCAGTGCTCACTT
JMSF005C02+ ATGAAATTTCTGGGGTGTCACTTGAAACAATACTCTCATCCCCCAAATCAGTGCTCACTT
                      ____________________________________________________________
consensus ATGAAATTTCTGGGGTGTCACTTGAAACAATACTCTCATCCCCCAAATCAGTGCTCACTT
 
. : . : . : . : . : . :
JMFS076B07+ CTACTGTTTCGGCTTTGTGAATCAACGGCGGCTCGTAATTCTCAACGGAGACGGTCAAAA
JMSF039A22+ CTACTGTTTCGGCTTTGTGAATCAACGGCGGCTCGTAATTCTCAACGGAGACGGTCAAAA
JMSF005C02+ CTACTGTTTCGGCTTTGTGAATCAACGGCGGCTCGTAATTCTCAACGGAGACGGTCAAAA
                      ____________________________________________________________
consensus CTACTGTTTCGGCTTTGTGAATCAACGGCGGCTCGTAATTCTCAACGGAGACGGTCAAAA
 
. : . : . : . : . : . :
JMFS076B07+ CTTTACCAAAATCGTCGCAGAGAGTCGCAATAGTTTGATCGTCCATGAGTAGACCACAAT
JMSF039A22+ CTTTACCAAAATCGTCGCAGAGAGTCGCAATAGTTTGATCGTCCATGAGTAGACCACAAT
JMSF005C02+ CTTTACCAAAATCGTCGCAGAGAGTCGCAATAGTTTGATCGTCCATGAGTAGACCACAAT
                      ____________________________________________________________
consensus CTTTACCAAAATCGTCGCAGAGAGTCGCAATAGTTTGATCGTCCATGAGTAGACCACAAT
 
. : . : . : . : . : . :
JMFS076B07+ TATCAGAAATCGGCAAAGAGTACAATGAATTTCAGAGCTCGCAGACCAAATGTAGTGGAG
JMSF039A22+ TATCAGAAATCGGCAAAGAGTACAATGAATTTCAGAGCTCGCAGACCAAATGTAGTGGAG
JMSF005C02+ TATCAGAAATCGGCAAAGAGTACAATGAATTTCAGAGCTCGCAGACCAAATGTAGTGGAG
                      ____________________________________________________________
consensus TATCAGAAATCGGCAAAGAGTACAATGAATTTCAGAGCTCGCAGACCAAATGTAGTGGAG
 
. : . : . : . : . : . :
JMFS076B07+ AAAGGAGAAGAAGACGAA
JMSF039A22+ AAAGGAGAAGAAGACGAAGTTGAAAGCTTGAGAGAGAGAGAGAGAGAGGACTAAACGGCC
JMSF005C02+ AAAGGAGAAGAAGACGAAGTTGAAAGCTTGAGAGAGAGAGAGAGAGAGGACTAAACGGCC
                      ____________________________________________________________
consensus AAAGGAGAAGAAGACGAAGTTGAAAGCTTGAGAGAGAGAGAGAGAGAGGACTAAACGGCC