Previous Contig 004678:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033C23Sequence447004678 (5)gb:AB049590_15208947e-39Avicennia marina chpa mRNA for chaperonin-60 alpha subunit, complete cds.814009757 (4)sp|P08926|RUBA_PEA8e-80RuBisCO subunit binding-protein alpha subunit, chloroplast precursor (60 kDa cha
JMFS066E12Sequence627004678 (5)gb:AB049590_15208943e-69Avicennia marina chpa mRNA for chaperonin-60 alpha subunit, complete cds.
JMSF002K22Sequence306004678 (5)gb:AB049590_15208943e-13Avicennia marina chpa mRNA for chaperonin-60 alpha subunit, complete cds.743009757 (4)sp|P08926|RUBA_PEA4e-73RuBisCO subunit binding-protein alpha subunit, chloroplast precursor (60 kDa cha
JMSF005B22Sequence287004678 (5)gb:AB049590_15208949e-07Avicennia marina chpa mRNA for chaperonin-60 alpha subunit, complete cds.
JMSF051P20Sequence671004678 (5)gb:AB049590_15208941e-82Avicennia marina chpa mRNA for chaperonin-60 alpha subunit, complete cds.738009757 (4)sp|P08926|RUBA_PEA1e-72RuBisCO subunit binding-protein alpha subunit, chloroplast precursor (60 kDa cha

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051P20+ CAGCAATCATGGTACCAATGGCTT
                      ____________________________________________________________
consensus CAGCAATCATGGTACCAATGGCTT
 
. : . : . : . : . : . :
JMSF051P20+ CATCATTTCCAGCTGAAATTGAAGCAATTGCTTTGATATCATCTCGACCTTTAACCGGTC
JMFS066E12+ ACCTTTAACCGGTC
                      ____________________________________________________________
consensus CATCATTTCCAGCTGAAATTGAAGCAATTGCTTTGATATCATCTCGACCTTTAACCGGTC
 
. : . : . : . : . : . :
JMSF051P20+ TAGCTTTATTTTCAAGCTCGTCCACCAAACCCTGTATAGTTTTGTCAATGCCCCTCTTTA
JMFS066E12+ TAGCTTTA-TTTCAAGCTCGTCCACCAAACCCTGTATAGTTTTGTCAATGCCCCTCTTTA
                      ____________________________________________________________
consensus TAGCTTTATTTTCAAGCTCGTCCACCAAACCCTGTATAGTTTTGTCAATGCCCCTCTTTA
 
. : . : . : . : . : . :
JMSF051P20+ TGGACACTGGGTTTGCACCAGATGTAACACTCAAGAGACCAAGTTTGATCATTTCACGTG
JMFS066E12+ TGGACACTGGGTTTGCACCAGATGTAACACTCAAGAGACCAAGTTTGATCATTTCACGTG
                      ____________________________________________________________
consensus TGGACACTGGGTTTGCACCAGATGTAACACTCAAGAGACCAAGTTTGATCATTTCACGTG
 
. : . : . : . : . : . :
JMSF051P20+ CAAGAACTGATGCAGTTGTTGTTCCATCACCAGCTGAATCATTGGTTTTGCTTGCAACCT
JMFS066E12+ CAAGAACTGATGCAGTTGTTGTTCCATCACCAGCTGAATCATTGGTTTTGCTTGCAACCT
                      ____________________________________________________________
consensus CAAGAACTGATGCAGTTGTTGTTCCATCACCAGCTGAATCATTGGTTTTGCTTGCAACCT
 
. : . : . : . : . : . :
JMSF051P20+ CCCTAATAAGGGCTGCACCAGCATTTTCCATAGGATCAGCAAGCTCTATAGCTCTAGCAA
JMFS066E12+ CCCTAATAAGGGCTGCACCAGCATTTTCCATAGGATCAGCAAGCTCTATAGCTCTAGCAA
JMFF033C23+ AGGGCTGCACCAGCATTTTCCATAGGATCAGCAAGCTCTATAGCTCTAGCAA
                      ____________________________________________________________
consensus CCCTAATAAGGGCTGCACCAGCATTTTCCATAGGATCAGCAAGCTCTATAGCTCTAGCAA
 
. : . : . : . : . : . :
JMSF051P20+ TTGTCACTCCATCATTAACAACTTTTGGAGTTCCAAATTCGTCCAACACAACATTCCTCC
JMFS066E12+ TTGTCACTCCATCATTAACAACTTTTGGAGTTCCAAATTCGTCCAACACAACATTCCTCC
JMFF033C23+ TTGTCACTCCATCATTAACAACTTTTGGAGTTCCAAATTCGTCCAACACAACATTCCTCC
                      ____________________________________________________________
consensus TTGTCACTCCATCATTAACAACTTTTGGAGTTCCAAATTCGTCCAACACAACATTCCTCC
 
. : . : . : . : . : . :
JMSF051P20+ CCCTGGGTCCAAGAGTGAGTCCGACGGCATCAGCGAGCTTATCGATGCCGGCCTGAAGAG
JMFS066E12+ CCCTGGGTCCAAGAGTGAGTCCGACGGCATCAGCGAGCTTATCGATGCCGGCCTGAAGAG
JMFF033C23+ CCCTGGGTCCAAGAGTGAGTCCGACGGCATCAGCGAGCTTATCGATGCCGGCCTGAAGAG
JMSF002K22+ CATCAGCGAGCTTATCGATGCCGGCCTGAAGAG
                      ____________________________________________________________
consensus CCCTGGGTCCAAGAGTGAGTCCGACGGCATCAGCGAGCTTATCGATGCCGGCCTGAAGAG
 
. : . : . : . : . : . :
JMSF051P20+ CGGTCCTGGATTTCTGGTCAAAAGCAATTTCCTTGGCATTAGCCCTCACCACAAACCGAT
JMFS066E12+ CGGTCCTGGATTTCTGGTCAAAAGCAATTTCCTTGGCATTAGCCCTCACCACAAACCGAT
JMFF033C23+ CGGTCCTGGATTTCTGGTCAAAAGCAATTTCCTTGGCATTAGCCCTCACCACAAACCGAT
JMSF002K22+ CGGTCCTGGATTTCTGGTCAAAAGCAATTTCCTTGGCATTAGCCCTCACCACAAACCGAT
JMSF005B22+ CTGGTCAAAAGCAATTTCCTTGGCATTAGCCCTCACCACAAACCGAT
                      ____________________________________________________________
consensus CGGTCCTGGATTTCTGGTCAAAAGCAATTTCCTTGGCATTAGCCCTCACCACAAACCGAT
 
. : . : . : . : . : . :
JMSF051P20+ TCTTCGAGTTCGACGTCTTGGGGTTGAAACTCCTCCCCTGCAGCTGGCTAGTCCTCCTAC
JMFS066E12+ TCTTCGAGTTCGACGTCTTGGGGTTGAAACTCCTCCCCTGCAGCTGGCTAGTCCTCCTAC
JMFF033C23+ TCTTCGAGTTCGACGTCTTGGGGTTGAAACTCCTCCCCTGCAGCTGGCTAGTCCTCCTAC
JMSF002K22+ TCTTCGAGTTCGACGTCTTGGGGTTGAAACTCCTCCCCTGCAGCTGGCTAGTCCTACTAC
JMSF005B22+ TCTTCGAGTTCGACGTCTTGGGGTTGAAACTACTCCCCTGCAGCTGGCTAGTCCTCCTAC
                      ____________________________________________________________
consensus TCTTCGAGTTCGACGTCTTGGGGTTGAAACTCCTCCCCTGCAGCTGGCTAGTCCTCCTAC
 
. : . : . : . : . : . :
JMSF051P20+ CACTCCTCAAACCCCCTCGATTGGAAGGTGAGGAGAGGATTGAGGCAGTTGAGATGGCGT
JMFS066E12+ CACTCCTCAAACCCCCTCGATTGGAAGGTGAGGAGAGGATTGAGGCAGTTGAGATGGCGT
JMFF033C23+ CACTCCTCAAACCCCCTCGATTGGAAGGTGAGGAGAGGATTGAGGCAGTTGAGATGGCGT
JMSF002K22+ CACTCCTCAAACCCCCTCGATTGGAAGGTGAGGAGAGGATTGAGGCAGTTGAGATGGCGT
JMSF005B22+ CACTCCTCAAACCCCCTCGATTGGAAGGTGAGGAGAGGATTGAGGCAGTTGAGATGGCGT
                      ____________________________________________________________
consensus CACTCCTCAAACCCCCTCGATTGGAAGGTGAGGAGAGGATTGAGGCAGTTGAGATGGCGT
 
. : . : . : . : . : . :
JMSF051P20+ TTGCGGAAGCCATTTCTGACGAGGAGTTAGCTTGCCTGCTTGGTGC
JMFS066E12+ TTGCGGAAGCCATTTCTGACGAGGAGTTAGCTTGCCTGCTTGGTGCGAGAGTGAGAGATG
JMFF033C23+ TTGCGGAAGCCATTTCTGACGAGGAGTTAGCTTGCCTGCTTGGTGCGAGAGTGAGAGATG
JMSF002K22+ TTGCGGAAGCCATTTCTGACGAGGAGTTAGCTTGCCTGCTTGGTGCGAGAGTGAGAGACG
JMSF005B22+ TTGCGGAAGCCATTTCTGACGAGGAGTTAGCTTGCCTGCTTGGTGCGAGAGTGAGAGATG
                      ____________________________________________________________
consensus TTGCGGAAGCCATTTCTGACGAGGAGTTAGCTTGCCTGCTTGGTGCGAGAGTGAGAGATG
 
. : . : . : . : . : . :
JMFS066E12+ ATTAGATAAGGTTT
JMFF033C23+ ATTAGATAAGGTTTTATGAGACGGAGGTTTT
JMSF002K22+ ATTAGATAAGGTTTTATGAGACGGAGGTTTT
JMSF005B22+ ATTAGATAAGGTTTTATGAGACGGAGGTTTTGAAGAGCGTTTGCTACTAGCTAGGGCTTC
                      ____________________________________________________________
consensus ATTAGATAAGGTTTTATGAGACGGAGGTTTTGAAGAGCGTTTGCTACTAGCTAGGGCTTC