Previous Contig 004676:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005B20Sequence309004676 (2)gb:AY065250_15664012e-29Arabidopsis thaliana putative alcohol dehydrogenase (At1g64710) mRNA, complete c298012960 (2)gb:AY640383_16189802e-16Helianthus annuus NIM1-like protein 1 (NML1) mRNA, complete cds.
JMSF018F13Sequence565004676 (2)gb:AY065250_15664012e-56Arabidopsis thaliana putative alcohol dehydrogenase (At1g64710) mRNA, complete c800011898 (2)gb:AY087044_15720804e-64Arabidopsis thaliana clone 30996 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018F13+ GAGGCAAGCAGAATCCAGGACAGTGTATT
                      ____________________________________________________________
consensus GAGGCAAGCAGAATCCAGGACAGTGTATT
 
. : . : . : . : . : . :
JMSF018F13+ CGGAGAAAGTGGAAGTGTTGAGGAAATGGTAGATTGGGTTCCCATCTTTGCTGGAAAACC
                      ____________________________________________________________
consensus CGGAGAAAGTGGAAGTGTTGAGGAAATGGTAGATTGGGTTCCCATCTTTGCTGGAAAACC
 
. : . : . : . : . : . :
JMSF018F13+ TGCACTTCCCGTCCCCCGCCATCACGCTTTTGAACGGATTCACTCTGAACTTCTTGCACA
                      ____________________________________________________________
consensus TGCACTTCCCGTCCCCCGCCATCACGCTTTTGAACGGATTCACTCTGAACTTCTTGCACA
 
. : . : . : . : . : . :
JMSF018F13+ GATTGGTCTTGCTGGATTTGCAGTAGGCGCAGTCGCCGCATTCCCCGTTGAATATCGCCA
                      ____________________________________________________________
consensus GATTGGTCTTGCTGGATTTGCAGTAGGCGCAGTCGCCGCATTCCCCGTTGAATATCGCCA
 
. : . : . : . : . : . :
JMSF018F13+ CCACCACGTCTCCGGCCTCCATTTCCGTCACGCCTTCTCCCACGCTTTCAACCACTCCAG
JMSF005B20+ CCACTCCAG
                      ____________________________________________________________
consensus CCACCACGTCTCCGGCCTCCATTTCCGTCACGCCTTCTCCCACGCTTTCAACCACTCCAG
 
. : . : . : . : . : . :
JMSF018F13+ AGGCTTCATGCCCAAGAATTCGAGGGAAAACACGTTGAGCTTGGTTCTCCCCTTTCCAAG
JMSF005B20+ AGGCTTCATGCCCAAGAATTCGAGGGAAAACACGTTGAGCTTGGTTCTCCCCTTTCCAAG
                      ____________________________________________________________
consensus AGGCTTCATGCCCAAGAATTCGAGGGAAAACACGTTGAGCTTGGTTCTCCCCTTTCCAAG
 
. : . : . : . : . : . :
JMSF018F13+ CACTGAGATCTGTGTGACATATTGAAGTGAAGAGGATCTTGATTCGAACCTCCAGCTTCT
JMSF005B20+ CACTGAGATCTGTGTGACATATTGAAGTGAAGAGGATCTTGATTCGAACCTCCAGCTTCT
                      ____________________________________________________________
consensus CACTGAGATCTGTGTGACATATTGAAGTGAAGAGGATCTTGATTCGAACCTCCAGCTTCT
 
. : . : . : . : . : . :
JMSF018F13+ GAGGCGGATCCACCAGCACATCCTCGATGATCAAGGGCTGGCCAGGACTGTACGCCACAG
JMSF005B20+ GAGGCGGATCCACCAGCACATCCTCGATGATCAAGGGCTGGCCAGGACTGTACGCCACAG
                      ____________________________________________________________
consensus GAGGCGGATCCACCAGCACATCCTCGATGATCAAGGGCTGGCCAGGACTGTACGCCACAG
 
. : . : . : . : . : . :
JMSF018F13+ CAGCTTTGCAGGTAATGACCTTGCCAGCAGTGTCAGCCGGAATGGAGAAGCCATGAACAG
JMSF005B20+ CAGCTTTGCAGGTAATGACCTTGCCAGCAGTGTCAGCCGGAATGGAGAAGCCATGAACAG
                      ____________________________________________________________
consensus CAGCTTTGCAGGTAATGACCTTGCCAGCAGTGTCAGCCGGAATGGAGAAGCCATGAACAG
 
. : . : . : . : . : . :
JMSF018F13+ AGTGGTTATCCAGAGAACCCATCGCGGTTAACTAGCTGTAGTATATATGTTAT
JMSF005B20+ AGTGGTTATCCAGAGAACCCATCGCGGTTAACTAGCTGTAGTATATATGTTATGTGAGTC
                      ____________________________________________________________
consensus AGTGGTTATCCAGAGAACCCATCGCGGTTAACTAGCTGTAGTATATATGTTATGTGAGTC