Previous Contig 004670:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS074E10Sequence634004670 (6)gb:AY445630_16065336e-62Trifolium pratense GTP-binding protein TypA mRNA, complete cds.
JMFS077G10Sequence624004670 (6)gb:AY445630_16065333e-60Trifolium pratense GTP-binding protein TypA mRNA, complete cds.
JMFS138H03Sequence616004670 (6)gb:AY445630_16065331e-58Trifolium pratense GTP-binding protein TypA mRNA, complete cds.
JMSF005B09Sequence232004670 (6)460010556 (14)sp|P49332|GTXC_TOBAC7e-32Probable glutathione S-transferase parC (EC 2.5.1.18) (Auxin-regulated protein p
JMSF023B10Sequence634004670 (6)gb:AY445630_16065331e-58Trifolium pratense GTP-binding protein TypA mRNA, complete cds.747003327 (3)gb:AY445630_16065331e-74Trifolium pratense GTP-binding protein TypA mRNA, complete cds.
JMSF046C10Sequence650004670 (6)gb:AY445630_16065334e-62Trifolium pratense GTP-binding protein TypA mRNA, complete cds.701003327 (3)gb:AY445630_16065333e-72Trifolium pratense GTP-binding protein TypA mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS138H03+ GAGGCATTGGACCCTCTACAGAATCTACCACTA
JMFS074E10+ TCAGAACGAATCTTGTCTGAGGCATTGGACCCTCTACAGAATCTACCACTA
JMFS077G10+ TGAGGCATTGGACCCTCTACAGAATCTACCACTA
JMSF046C10+ CAGAACGAATCTTGTCTGAGGCATTGGACCCTCTACAGAATCTACCACTA
JMSF023B10+ TGAGGCATTGGACCCTCTACAGAATCTACCACTA
                      ____________________________________________________________
consensus TCAGAACGAATCTTGTCTGAGGCATTGGACCCTCTACAGAATCTACCACTA
 
. : . : . : . : . : . :
JMFS138H03+ AAAGAACTCCTTCCACCATGTTAATGATGCGCTCCACTTCACCTCCAAAGTCTGAATGGC
JMFS074E10+ AAAGAACTCCTTCCACCATGTTAATGATGCGCTCCACTTCACCTCCAAAGTCTGAATGGC
JMFS077G10+ AAAGAACTCCTTCCACCATGTTAATGATGCGCTCCACTTCACCTCCAAAGTCTGAATGGC
JMSF046C10+ AAAGAACTCCTTCCACCATGTTAAGGATGCGCTCCACTTCACCTCCAAAGTCTGAATGGC
JMSF023B10+ AAAGAACTCCTTCCACCATGTTAATGATGCGCTCCACTTCACCTCCAAAGTCTGAATGGC
                      ____________________________________________________________
consensus AAAGAACTCCTTCCACCATGTTAATGATGCGCTCCACTTCACCTCCAAAGTCTGAATGGC
 
. : . : . : . : . : . :
JMFS138H03+ CAGGAGTATCGATTATATTTATTTTGGTATTGTTGTAAGTAATTGAGGTGTTTTTGCTAA
JMFS074E10+ CAGGAGTATCGATTATATTTATTTTGGTATTGTTGTAAGTAATTGAGGTGTTTTTGCTAA
JMFS077G10+ CAGGAGTATCGATTATATTTATTTTGGTATTGTTGTAAGTAATTGAGGTGTTTTTGCTAA
JMSF046C10+ CAGGAGTATCGATTATATTTATTTTGGTATTGTTGTAAGTAATTGAGGTGTTTTTGCTAA
JMSF023B10+ CAGGAGTATCGATTATATTTATTTTGGTATTGTTGTAAGTAATTGAGGTGTTTTTGCTAA
                      ____________________________________________________________
consensus CAGGAGTATCGATTATATTTATTTTGGTATTGTTGTAAGTAATTGAGGTGTTTTTGCTAA
 
. : . : . : . : . : . :
JMFS138H03+ GTATTGTTATTCCCCTTTCACGCTCCAGATCATTTGAATCCATTATCCTTTCCTGTACAA
JMFS074E10+ GTATTGTTATTCCCCTTTCACGCTCCAGATCATTTGAATCCATTATCCTTTCCTGTACAA
JMFS077G10+ GTATTGTTATTCCCCTTTCACGCTCCAGATCATTTGAATCCATTATCCTTTCCTGTACAA
JMSF046C10+ GTATTGTTATTCCCCTTTCACGCTCCAGATCATTTGAATCCATTATCCTTTCCTGTACAA
JMSF023B10+ GTATTGTTATTCCCCTTTCACGCTCCAGATCATTTGAATCCATTATCCTTTCCTGTACAA
                      ____________________________________________________________
consensus GTATTGTTATTCCCCTTTCACGCTCCAGATCATTTGAATCCATTATCCTTTCCTGTACAA
 
. : . : . : . : . : . :
JMFS138H03+ ACTGATTGTCTCGAAACACCTTTGCTTGTCTCAACATCGCATCCACCAGTGTGGTCTTCC
JMFS074E10+ ACTGATTGTCTCGAAACACCTTTGCTTGTCTCAACATCGCATCCACCAGTGTGGTCTTCC
JMFS077G10+ ACTGATTGTCTCGAAACACCTTTGCTTGTCTCAACATCGCATCCACCAGTGTGGTCTTCC
JMSF046C10+ ACTGATTGTCTCGAAACACCTTTGCTTGTCTCAACATCGCATCCACCAGTGTGGTCTTCC
JMSF023B10+ ACTGATTGTCTCGAAACACCTTTGCTTGTCTCAACATCGCATCCACCAGTGTGGTCTTCC
                      ____________________________________________________________
consensus ACTGATTGTCTCGAAACACCTTTGCTTGTCTCAACATCGCATCCACCAGTGTGGTCTTCC
 
. : . : . : . : . : . :
JMFS138H03+ CATGATCTACATGAGCCACAATCGCTATATTCCTTATGTCACTTCTCCTCATTAACTGGT
JMFS074E10+ CATGATCTACATGAGCCACAATCGCTATATTCCTTATGTCACTTCTCCTCATTAACTGGT
JMFS077G10+ CATGATCTACATGAGCCACAATCGCTATATTCCTTATGTCACTTCTCCTCATTAACTGGT
JMSF046C10+ CATGATCTACATGAGCCACAATCGCTATATTCCTTATGTCACTTCTCCTCATTAACTGGT
JMSF023B10+ CATGATCTACATGAGCCACAATCGCTATATTCCTTATGTCACTTCTCCTCATTAACTGGT
                      ____________________________________________________________
consensus CATGATCTACATGAGCCACAATCGCTATATTCCTTATGTCACTTCTCCTCATTAACTGGT
 
. : . : . : . : . : . :
JMFS138H03+ TCTTTGTCTCAGTGGAGAGTTCAGCGGCCTGAGAAGCAGAGCATTTGATAGAACTCCGCA
JMFS074E10+ TCTTTGTCTCAGTGGAGAGTTCAGCGGCCTGAGAAGCAGAGCATTTGATAGAACTCCGCA
JMFS077G10+ TCTTTGTCTCAGTGGAGAGTTCAGCGGCCTGAGAAGCAGAGCATTTGATAGAACTCCGCA
JMSF046C10+ TCTTTGTCTCAGTGGAGAGTTCAGCGGCCTGAGAAGCAGAGCATTTGATAGAACTCCGCA
JMSF023B10+ TCTTTGTCTCAGTGGAGAGTTCAGCGGCCTGAGAAGCAGAGCATTTGATAGAACTCCGCA
                      ____________________________________________________________
consensus TCTTTGTCTCAGTGGAGAGTTCAGCGGCCTGAGAAGCAGAGCATTTGATAGAACTCCGCA
 
. : . : . : . : . : . :
JMFS138H03+ GTGGGTTTACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
JMFS074E10+ GTGGGTTTACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
JMFS077G10+ GTGGGTTTACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
JMSF046C10+ GTGGGTTTACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
JMSF023B10+ GTGGGTTTACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
JMSF005B09+ ACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
                      ____________________________________________________________
consensus GTGGGTTTACTGAGCAGAGCTGGAAAGGAGCTTTGGCTGTCAAACAAGAAGCCAACTTGC
 
. : . : . : . : . : . :
JMFS138H03+ TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
JMFS074E10+ TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
JMFS077G10+ TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
JMSF046C10+ TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
JMSF023B10+ TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
JMSF005B09+ TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
                      ____________________________________________________________
consensus TCCCAAAGAAACGATTTTTCAAGAAAGGTGAAGAAAGACTGGCGCTTTTTGTGCTGCCAA
 
. : . : . : . : . : . :
JMFS138H03+ GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
JMFS074E10+ GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
JMFS077G10+ GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
JMSF046C10+ GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
JMSF023B10+ GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
JMSF005B09+ GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
                      ____________________________________________________________
consensus GAATAGGGTTTCTCAGAGGGAGAGTAGCGGGAGTGATAAAAGAGTGTGAACCAATCGCCA
 
. : . : . : . : . : . :
JMFS138H03+ TCTCCATTTCTCACTCTCTGCCTTGCGTTAAGCTCAGAGTTTG
JMFS074E10+ TCTCCATTTCTCACTCTCTGCCTTGCGTTAAGCTCAGAGTTTG
JMFS077G10+ TCTCCATTTCTCACTCTCTGCCTTGCGTTAAGCTCAGAGTTTG
JMSF046C10+ TCTCCATTTCTCACTCTNTGCCTTGCGTTAAGCTCAGAGTTTGTTGTGCAGAGAGGAC
JMSF023B10+ TCTCCATTTCTCACTCTCTGCCTTGCGTTAAGCTCAGAGTTTGTTGTGCAGAGAGGAC
JMSF005B09+ TCTCCATTTCTCACTCTCTGCCTTGCGTTAAGCTCAGAGTTTGTTGTGCAGAGAGGACCC
                      ____________________________________________________________
consensus TCTCCATTTCTCACTCTCTGCCTTGCGTTAAGCTCAGAGTTTGTTGTGCAGAGAGGACCC