Previous Contig 004669:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005B08Sequence240004669 (2)
JMSF031A06Sequence634004669 (2)pir|T46132|T461321e-20hypothetical protein T2J13.180 - Arabidopsis thaliana>gb:ATT2J13_1555709 Arabido768011334 (2)pir|T46132|T461324e-81hypothetical protein T2J13.180 - Arabidopsis thaliana>gb:ATT2J13_1555709 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031A06+ GGTAGGCCTGTGTATACGTCTCTACATACGCCCT
                      ____________________________________________________________
consensus GGTAGGCCTGTGTATACGTCTCTACATACGCCCT
 
. : . : . : . : . : . :
JMSF031A06+ CCCGTTCAATATTACGAGTCTGAAGTTAGCGGTCCGGTTCGCTCTCTCCACCATTTCCAA
                      ____________________________________________________________
consensus CCCGTTCAATATTACGAGTCTGAAGTTAGCGGTCCGGTTCGCTCTCTCCACCATTTCCAA
 
. : . : . : . : . : . :
JMSF031A06+ AGTTATCCCCGTCTCCCTCCATGGTTTTAAATCTTCATAGATCCAGCGGAAGTACTGGGG
                      ____________________________________________________________
consensus AGTTATCCCCGTCTCCCTCCATGGTTTTAAATCTTCATAGATCCAGCGGAAGTACTGGGG
 
. : . : . : . : . : . :
JMSF031A06+ ACAATTATAAGCGATATCCAGAGGGGTTTCAGGAGGAACGTGGTAATCTGGTGGGTAGTA
                      ____________________________________________________________
consensus ACAATTATAAGCGATATCCAGAGGGGTTTCAGGAGGAACGTGGTAATCTGGTGGGTAGTA
 
. : . : . : . : . : . :
JMSF031A06+ CTTTTTAGGGCATGTTCTTGTGAGGCTACCAAATAAGCAATTTATTGGAAATTCCCGAGT
                      ____________________________________________________________
consensus CTTTTTAGGGCATGTTCTTGTGAGGCTACCAAATAAGCAATTTATTGGAAATTCCCGAGT
 
. : . : . : . : . : . :
JMSF031A06+ CTCAGTAAGCAGTTTCTCGTTTACGGGTTCAGTTATGCCTAGCATTGCAGCCCATATGTA
                      ____________________________________________________________
consensus CTCAGTAAGCAGTTTCTCGTTTACGGGTTCAGTTATGCCTAGCATTGCAGCCCATATGTA
 
. : . : . : . : . : . :
JMSF031A06+ TAGAAAGAACCCGAGGAGAAAGACGAAGGCGACACCAGAAATTATAACATTAGGCTTGTT
                      ____________________________________________________________
consensus TAGAAAGAACCCGAGGAGAAAGACGAAGGCGACACCAGAAATTATAACATTAGGCTTGTT
 
. : . : . : . : . : . :
JMSF031A06+ TCCAACATAGTGAAGCCGGAACCTCTCTGCACTATAATGTCTATCACCTCCATGCCTATG
JMSF005B08+ TCCAACATAGTGAAGCCGGAACCTCTCTGCACTATAATGTCTATCACCTCCATGCCTATG
                      ____________________________________________________________
consensus TCCAACATAGTGAAGCCGGAACCTCTCTGCACTATAATGTCTATCACCTCCATGCCTATG
 
. : . : . : . : . : . :
JMSF031A06+ ATGATGCCCCTGCATACTATTCCCCAGCTGTCTTCTCCACCGTCTCAACGGGGCTATCCA
JMSF005B08+ ATGATGCCCCTGCATACTATTCCCCAGCTGTCTTCTCCACCGTCTCAACGGGGCTATCCA
                      ____________________________________________________________
consensus ATGATGCCCCTGCATACTATTCCCCAGCTGTCTTCTCCACCGTCTCAACGGGGCTATCCA
 
. : . : . : . : . : . :
JMSF031A06+ GCAGCACAAATTACGCCTATTCGAATCCCCCCTAAAACGACCTCAGTTTCTTCTGATGCT
JMSF005B08+ GCAGCACAAATTACGCCTATTCGAATCCCCCCTAAAACGACCTCAGTTTCTTCTGATGCT
                      ____________________________________________________________
consensus GCAGCACAAATTACGCCTATTCGAATCCCCCCTAAAACGACCTCAGTTTCTTCTGATGCT
 
. : . : . : . : . : . :
JMSF031A06+ GCAGGCTCCTGTACAGCATTCTCTAATTAGCTGCTTCTGTTCTTCATCTTTTCCTGTCTC
JMSF005B08+ GCAGGCTCCTGTACAGCATTCTCTAATTAGCTGCTTCTGTTCTTCATCTTTTCCTGTCTC
                      ____________________________________________________________
consensus GCAGGCTCCTGTACAGCATTCTCTAATTAGCTGCTTCTGTTCTTCATCTTTTCCTGTCTC