Previous Contig 004664:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015J17Sequence539004664 (2)sp|O04397|FENS_TOBAC4e-37Ferredoxin--NADP reductase, root-type isozyme, chloroplast precursor (EC 1.18.1.759008930 (3)gb:PSFERNO_17021377e-85P.sativum mRNA for ferrodoxin NADP oxidoreductase.
JMSF005A04Sequence265004664 (2)132008930 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015J17+ ATCACAATATGACAGGTCTCCCCAGGAGCTTTAGGGCCTACAAGCCTCTCAACAGAGACA
                      ____________________________________________________________
consensus ATCACAATATGACAGGTCTCCCCAGGAGCTTTAGGGCCTACAAGCCTCTCAACAGAGACA
 
. : . : . : . : . : . :
JMFF015J17+ ATTGTTGCAGTGTATGGCTCCTTTGGTTTGTACAGATTCAATGGAGGTTCCTTTGCATCT
                      ____________________________________________________________
consensus ATTGTTGCAGTGTATGGCTCCTTTGGTTTGTACAGATTCAATGGAGGTTCCTTTGCATCT
 
. : . : . : . : . : . :
JMFF015J17+ TCTAGAGACAAAGGTGAAACAGTCACTTTAGGTTTGCTAGCCTGTTGTACAGACATGCAA
                      ____________________________________________________________
consensus TCTAGAGACAAAGGTGAAACAGTCACTTTAGGTTTGCTAGCCTGTTGTACAGACATGCAA
 
. : . : . : . : . : . :
JMFF015J17+ ACAAAATTGTTTCTCCTGGATTTTCCATTTGAGGTTTTCAAGTTGAAATGTTGGAAATCG
                      ____________________________________________________________
consensus ACAAAATTGTTTCTCCTGGATTTTCCATTTGAGGTTTTCAAGTTGAAATGTTGGAAATCG
 
. : . : . : . : . : . :
JMFF015J17+ GTCCATGATTTATTGTTGAAACCTAAGTTAGCCTTAAAGACGGATTTTCGCACGGACGAA
JMSF005A04+ AAAGACGGATTTTCGCACGGACGAA
                      ____________________________________________________________
consensus GTCCATGATTTATTGTTGAAACCTAAGTTAGCCTTAAAGACGGATTTTCGCACGGACGAA
 
. : . : . : . : . : . :
JMFF015J17+ TCAGCATTGAAAGGGACAGCAAAAGTGACCTGAGTGACGGCAGAATGAGCCATGATCGCA
JMSF005A04+ TCAGCATTGAAAGGGACAGCAAAAGTGACCTGAGTGACGGCAGAATGAGCCATGATCGCA
                      ____________________________________________________________
consensus TCAGCATTGAAAGGGACAGCAAAAGTGACCTGAGTGACGGCAGAATGAGCCATGATCGCA
 
. : . : . : . : . : . :
JMFF015J17+ ACAGATACACAGCTTTACTGTCTCAAGGCTTGTGTGAGGAAAATTTGCAGTGGAAATGCT
JMSF005A04+ ACAGATACACAGCTTTACTGTCTCAAGGCTTGTGTGAGGAAAATTTGCAGTGGAAATGCT
                      ____________________________________________________________
consensus ACAGATACACAGCTTTACTGTCTCAAGGCTTGTGTGAGGAAAATTTGCAGTGGAAATGCT
 
. : . : . : . : . : . :
JMFF015J17+ GAAAGACAATAGAAATATATATATATATATTTCCCGCTTGGGATTTGAGAAGGAGAAGGG
JMSF005A04+ GAAAGACAATAGAAATATATATATATATATTTCCCGCTTGGGATTTGAGAAGGAGAAGGG
                      ____________________________________________________________
consensus GAAAGACAATAGAAATATATATATATATATTTCCCGCTTGGGATTTGAGAAGGAGAAGGG
 
. : . : . : . : . : . :
JMFF015J17+ GGGAAAGGGAAGAAGAGAACAATTTGGAATTTGGTTGAGGAAGTGAGGTTTGATCCCT
JMSF005A04+ GGGAAAGGGAAGAAGAGAACAATTTGGAATTTGGTTGAGGAAGTGAGGTTTGATCCCTCC
                      ____________________________________________________________
consensus GGGAAAGGGAAGAAGAGAACAATTTGGAATTTGGTTGAGGAAGTGAGGTTTGATCCCTCC