Previous Contig 004649:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS013G07Sequence574004649 (8)gb:AY056113_15634501e-25Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220
JMFS165E12Sequence606004649 (8)gb:AY056113_15634501e-25Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220
JMFS168H08Sequence579004649 (8)gb:AY056113_15634501e-25Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220
JMSF001B03Sequence273004649 (8)gb:AY056113_15634507e-15Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220 803013383 (3)pir|T47641|T476411e-53hypothetical protein T15C9.20 - Arabidopsis thaliana>gb:ATT15C9_1554514 Arabidop
JMSF004N17Sequence281004649 (8)gb:AY056113_15634502e-09Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220
JMSF005O04Sequence281004649 (8)gb:AY056113_15634502e-09Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220 353013383 (3)
JMSF040F16Sequence600004649 (8)gb:AY056113_15634503e-34Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220
JMSF041O12Sequence646004649 (8)gb:AY056113_15634501e-28Arabidopsis thaliana AT3g55020/T15C9_20 mRNA, complete cds.>gb:AY113060_1578220 711013383 (3)pir|T47641|T476412e-22hypothetical protein T15C9.20 - Arabidopsis thaliana>gb:ATT15C9_1554514 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040F16+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
JMSF040F16+ ATCTGTCCAAAGATTCTGACCTATCCATATCATAGAACTCATCCTCTGAGTCCTCTTCAA
JMSF041O12+ CTTCAA
                      ____________________________________________________________
consensus ATCTGTCCAAAGATTCTGACCTATCCATATCATAGAACTCATCCTCTGAGTCCTCTTCAA
 
. : . : . : . : . : . :
JMSF040F16+ GAGCTCCTTTCGTGGGTTTAGCCTCTTCTATGGTAGAAGAATGCTCCACCATTCCAGAGT
JMFS168H08+ CATTCCAGAGT
JMFS013G07+ GAATGCTCCACCATTCCAGAGT
JMSF041O12+ GAGCTCCTTTCGTGGGTTTAGCCTCTTCTATGGTAGAAGAATGCTCCACCATTCCAGAGT
JMFS165E12+ TTCCAGAGT
                      ____________________________________________________________
consensus GAGCTCCTTTCGTGGGTTTAGCCTCTTCTATGGTAGAAGAATGCTCCACCATTCCAGAGT
 
. : . : . : . : . : . :
JMSF040F16+ CTTGCTCACTTTNGACTTTATTTACCCTTTTAACACGCACGCTCATCATATCCTCAATGG
JMFS168H08+ CTTGCTCACTTTTGACTTTATTTACCCTTTTAACACGCACGCTCATCATATCCTCAATGG
JMFS013G07+ CTTGCTCACTTTTGACTTTATTTACCCTTTTAACACGCACGCTCATCATATCCTCAATGG
JMSF041O12+ CTTGCTCACTTTTGACTTTATTTACCCTTTTAACACGCACGCTCATCATATCCTCAATGG
JMFS165E12+ CTTGCTCACTTTTGACTTTATTTACCCTTTTAACACGCACGCTCATCATATCCTCAATGG
                      ____________________________________________________________
consensus CTTGCTCACTTTTGACTTTATTTACCCTTTTAACACGCACGCTCATCATATCCTCAATGG
 
. : . : . : . : . : . :
JMSF040F16+ CTCTAAGTGATGATCTAACTTCAGACCATACTTGGATCTGGTGGGTTTTTTTCTTAGTTG
JMFS168H08+ CTCTAAGTGATGATCTAACTTCAGACCATACTTGGATCTGGTGGGTTTTTTTCTCAGTTG
JMFS013G07+ CTCTAAGTGATGATCTAACTTCAGACCATACTTGGATCTGGTGGGTTTTTTTCTCAGTTG
JMSF041O12+ CTCTAAGTGATGATCTAACTTCAGACCATACTTGGATCTGGTGGGTTTTTTTCTCAGTTG
JMFS165E12+ CTCTAAGTGATGATCTAACTTCAGACCATACTTGGATCTGGTGGGTTTTTTTCTCAGTTG
                      ____________________________________________________________
consensus CTCTAAGTGATGATCTAACTTCAGACCATACTTGGATCTGGTGGGTTTTTTTCTCAGTTG
 
. : . : . : . : . : . :
JMSF040F16+ ATGTTGGTATCTCTTTTATCTCCATTTGATTTTCAATACCATTCTGAGAATGAGAATCTG
JMFS168H08+ ATGTTGGTATCTCTTTTATCTCCATTTGATTTTCAATACCATTCTGAGAATGAGAATCTG
JMFS013G07+ ATGTTGGTATCTCTTTTATCTCCATTTGATTTTCAATACCATTCTGAGAATGAGAATCTG
JMSF041O12+ ATGTTGGTATCTCTTTTATCTCCATTTGATTTTCAATACCATTCTGAGAATGAGAATCTG
JMFS165E12+ ATGTTGGTATCTCTTTTATCTCCATTTGATTTTCAATACCATTCTGAGAATGAGAATCTG
                      ____________________________________________________________
consensus ATGTTGGTATCTCTTTTATCTCCATTTGATTTTCAATACCATTCTGAGAATGAGAATCTG
 
. : . : . : . : . : . :
JMSF040F16+ GTTCCTTCNTGATTGGCTCATCAGACAGCTCTTCACAAGTGTTGCCTGAAGATGTTCCAN
JMFS168H08+ GTTCCTTCTTGATTGGCTCATCAGACAGCTCTTCACAAGTGTTGCCTGAAGATGTTCCAT
JMFS013G07+ GTTCCTTCTTGATTGGCTCATCAGACAGCTCTTCACAAGTGTTGCCTGAAGATGTTCCAT
JMSF041O12+ GTTCCTTCTTGATTGGCTCATCAGACAGCTCTTCACAAGTGTTGCCTGAAGATGTTCCAT
JMFS165E12+ GTTCCTTCTTGATTGGCTCATCAGACAGCTCTTCACAAGTGTTGCCTGAAGATGTTCCAT
                      ____________________________________________________________
consensus GTTCCTTCTTGATTGGCTCATCAGACAGCTCTTCACAAGTGTTGCCTGAAGATGTTCCAT
 
. : . : . : . : . : . :
JMSF040F16+ TTATGGGCAACTGAGCAAAATCCGATTGCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
JMFS168H08+ TTATGGGCAACTGAGCAAAATCCGATTGCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
JMSF001B03+ GCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
JMFS013G07+ TTATGGGCAACTGAGCAAAATCCGATTGCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
JMSF041O12+ TTATGGGCAACTGAGCAAAATCCGATTGCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
JMFS165E12+ TTATGGGCAACTGAGCAAAATCCGATTGCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
                      ____________________________________________________________
consensus TTATGGGCAACTGAGCAAAATCCGATTGCCGTTCCAGAAAGTCTGTCCACCTGTCAGATC
 
. : . : . : . : . : . :
JMSF040F16+ TCCCCTCCTCTTNTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMFS168H08+ TCTCCTCCTCTTCTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMSF001B03+ TCTCCTCCTCTTCTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMFS013G07+ TCTCCTCCTCTTCTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMSF041O12+ TCTCCTCCTCTTCTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMFS165E12+ TCTCCTCCTCTTCTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMSF005O04+ GTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
JMSF004N17+ GTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
                      ____________________________________________________________
consensus TCTCCTCCTCTTCTTCCTTGTAGATATTAGCATATTCACGATATCTTTGTACATGCTGGG
 
. : . : . : . : . : . :
JMSF040F16+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMFS168H08+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMSF001B03+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMFS013G07+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMSF041O12+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMFS165E12+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMSF005O04+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
JMSF004N17+ GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
                      ____________________________________________________________
consensus GCCTCACTGCAAACCCATAAGCATCCCTCTTGTGATCGGCAGAGATGCGCGGAGGATTAA
 
. : . : . : . : . : . :
JMSF040F16+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGG
JMFS168H08+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
JMSF001B03+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
JMFS013G07+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
JMSF041O12+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
JMFS165E12+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
JMSF005O04+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
JMSF004N17+ GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
                      ____________________________________________________________
consensus GCACCGCCACCGCCGTTCCTGCTGATACTGAATTCGCTTTCGCCTTCATTATCGGGCAAC
 
. : . : . : . : . : . :
JMFS168H08+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
JMSF001B03+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGC
JMFS013G07+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
JMSF041O12+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
JMFS165E12+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
JMSF005O04+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
JMSF004N17+ AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
                      ____________________________________________________________
consensus AAATTCGCGGACTATTCCCAGATTTTAATGGAATTCCCCTCCCCCCCTAGATTTTCTGCA
 
. : . : . : . : . : . :
JMFS168H08+ ACTAAAATGAAGAAAAAATTGGGAATTT
JMFS013G07+ ACTAAAATGAAG
JMSF041O12+ ACTAAAATGAAGAAAAAATTGGGAATTTTCAAAATG
JMFS165E12+ ACTAAAATGAAGAAAAAATTGGGAATTTTCAAAATGGGCGAACGATTTTGGACTCAA
JMSF005O04+ ACTAAAATGAAGAAAAAATTGGGAATTTTCAAAATGGGCGAACGATTTTGGACTCAA
JMSF004N17+ ACTAAAATGAAGAAAAAATTGGGAATTTTCAAAATGGGCGAACGATTTTGGACTCAAACC
                      ____________________________________________________________
consensus ACTAAAATGAAGAAAAAATTGGGAATTTTCAAAATGGGCGAACGATTTTGGACTCAAACC