Previous Contig 004645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004N05Sequence398004645 (2)sp|P41153|HSF8_LYCPE3e-28Heat shock factor protein HSF8 (Heat shock transcription factor 8) (HSTF 8) (Hea284007302 (13)gb:AB126259_15282629e-15Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF042D10Sequence795004645 (2)sp|Q9SCW5|HSF2_ARATH1e-79Heat shock factor protein 2 (HSF 2) (Heat shock transcription factor 2) (HSTF 2)751023977gb:AY344485_16009482e-10Oryza sativa (japonica cultivar-group) heat shock factor RHSF3 mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042D10+ CACTCCAGAAATGCGCACTTTGTCACTNTGCT
                      ____________________________________________________________
consensus CACTCCAGAAATGCGCACTTTGTCACTNTGCT
 
. : . : . : . : . : . :
JMSF042D10+ GATGAACCATCTGGGCTACAAAACTAGGGCTTTGCATGGCCTTTGCAAGGAATGACATCA
                      ____________________________________________________________
consensus GATGAACCATCTGGGCTACAAAACTAGGGCTTTGCATGGCCTTTGCAAGGAATGACATCA
 
. : . : . : . : . : . :
JMSF042D10+ TTTGCTGCTGCCGCTGTTCCATCATATGAACCTTCTGCCCAACATTCTGCAACTGGTGAT
                      ____________________________________________________________
consensus TTTGCTGCTGCCGCTGTTCCATCATATGAACCTTCTGCCCAACATTCTGCAACTGGTGAT
 
. : . : . : . : . : . :
JMSF042D10+ CTGTTGCCTGCTGCTGTTGTCTCAACTTGACAAGCTCCTGCATGAGAATATTTTTATCTC
                      ____________________________________________________________
consensus CTGTTGCCTGCTGCTGTTGTCTCAACTTGACAAGCTCCTGCATGAGAATATTTTTATCTC
 
. : . : . : . : . : . :
JMSF042D10+ TTTTAAGCCTATCCACCTCTTCCTCTAGCCCAAATTTCCCAACTTCAACACATGATCCAA
                      ____________________________________________________________
consensus TTTTAAGCCTATCCACCTCTTCCTCTAGCCCAAATTTCCCAACTTCAACACATGATCCAA
 
. : . : . : . : . : . :
JMSF042D10+ CTGAACTGTTTTGAACTTGAGGTGGTGGTGGTTGATGTGACTGCACATGCTTTCTCCTGG
                      ____________________________________________________________
consensus CTGAACTGTTTTGAACTTGAGGTGGTGGTGGTTGATGTGACTGCACATGCTTTCTCCTGG
 
. : . : . : . : . : . :
JMSF042D10+ TTATACTCTTTAAGAGGTGTCTATGACCTCTAAGAAATCCCTCATTAGCAAACTCCCAGC
                      ____________________________________________________________
consensus TTATACTCTTTAAGAGGTGTCTATGACCTCTAAGAAATCCCTCATTAGCAAACTCCCAGC
 
. : . : . : . : . : . :
JMSF042D10+ GATCAGGGTCGACTTTCCTGAACCCGTAAGTGTTCAATTGTCTGACAAAACTGGAGAAAT
JMSF004N05+ CCCGTAAGTGTTCAATTGTCTGACAAAACTGGAGAAAT
                      ____________________________________________________________
consensus GATCAGGGTCGACTTTCCTGAACCCGTAAGTGTTCAATTGTCTGACAAAACTGGAGAAAT
 
. : . : . : . : . : . :
JMSF042D10+ TGTTGTGCTTGAAGTACTTGGGCAAAATATCTTTAGCGAACTCGGGGACGTTCCACACGA
JMSF004N05+ TGTTGTGCTTGAAGTACTTGGGCAAAATATCTTTAGCGAACTCGGGGACGTTCCACACGA
                      ____________________________________________________________
consensus TGTTGTGCTTGAAGTACTTGGGCAAAATATCTTTAGCGAACTCGGGGACGTTCCACACGA
 
. : . : . : . : . : . :
JMSF042D10+ CGAAACTGTTATTGCTCTTGCTCCAGGACACCACGGCGTCCGTCGACGGATCCTCCACCA
JMSF004N05+ CGAAACTGTTATTGCTCTTGCTCCAGGACACCACGGCGTCCGTCGACGGATCCTCCACCA
                      ____________________________________________________________
consensus CGAAACTGTTATTGCTCTTGCTCCAGGACACCACGGCGTCCGTCGACGGATCCTCCACCA
 
. : . : . : . : . : . :
JMSF042D10+ TATCATACGTTTTGCTCAGAAAAGGCGGCGGCGAATTCCCGGCAGCCGCGGCGGCGCTTT
JMSF004N05+ TATCATACGTTTTGCTCAGAAAAGGCGGCGGCGAATTCCCGGCAGCCGCGGCGGCGCTTT
                      ____________________________________________________________
consensus TATCATACGTTTTGCTCAGAAAAGGCGGCGGCGAATTCCCGGCAGCCGCGGCGGCGCTTT
 
. : . : . : . : . : . :
JMSF042D10+ CCTGACCACCGTCCATGTTTCCCGATGGTCCTCCACTTAGGTAGACTCGCCTGACGCTTC
JMSF004N05+ CCTGACCACCGTCCATGTTTCCCGATGGTCCTCCACTTAGGTAGACTCGCCTGACGCTTC
                      ____________________________________________________________
consensus CCTGACCACCGTCCATGTTTCCCGATGGTCCTCCACTTAGGTAGACTCGCCTGACGCTTC
 
. : . : . : . : . : . :
JMSF042D10+ TGACGATCAACGAAATTGTAGATATTAGATCAGGATAGAGAGAGTGAGAGAGCGATGAAG
JMSF004N05+ TGACGATCAACGAAATTGTAGATATTAGATCAGGATAGAGAGAGTGAGAGAGCGATGAAG
                      ____________________________________________________________
consensus TGACGATCAACGAAATTGTAGATATTAGATCAGGATAGAGAGAGTGAGAGAGCGATGAAG
 
. : . : . : . : . : . :
JMSF042D10+ ATGAGAGAGAAAGAGGTATGGAGGAAGGGAAAGGAATGGAGC
JMSF004N05+ ATGAGAGAGAAAGAGGTATGGAGGAAGGGAAAGGAATGGAGCGACGAGTGACTGGCACCC
                      ____________________________________________________________
consensus ATGAGAGAGAAAGAGGTATGGAGGAAGGGAAAGGAATGGAGCGACGAGTGACTGGCACCC