Previous Contig 004635:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004B05Sequence541004635 (5)gb:STBIMPP_17227285e-47S.tuberosum mRNA for beta-I MPP.583008307 (5)gb:AF297643_17840783e-31Cucumis melo mitochondrial processing peptidase beta subunit mRNA, complete cds;
JMFS119H07Sequence609004635 (5)gb:STBIMPP_17227284e-58S.tuberosum mRNA for beta-I MPP.
JMSF004L06Sequence437004635 (5)gb:STBIMPP_17227288e-30S.tuberosum mRNA for beta-I MPP.262008307 (5)
JMSF015B20Sequence231004635 (5)686008307 (5)gb:AF363285_17915232e-51Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear
JMSF022J15Sequence656004635 (5)gb:STBIMPP_17227282e-62S.tuberosum mRNA for beta-I MPP.653008307 (5)gb:AF363285_17915237e-46Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022J15+ ATCCTCGAACTTCGGGTTCTGCA
                      ____________________________________________________________
consensus ATCCTCGAACTTCGGGTTCTGCA
 
. : . : . : . : . : . :
JMSF022J15+ CTATGTCAGATAGAAGTTGGAGCGCCCTGGTCACGTCCTTGCTCTGGACTTTGGCACAGT
JMFS119H07+ GTCACGTCCTTGCTCTGGACTTTGGCACAGT
                      ____________________________________________________________
consensus CTATGTCAGATAGAAGTTGGAGCGCCCTGGTCACGTCCTTGCTCTGGACTTTGGCACAGT
 
. : . : . : . : . : . :
JMSF022J15+ ACGTGGTCATTTCCCTAGAAGTGGAACCACTAATGTGCCCTCCCATGTTCTCAACCTCCT
JMFS119H07+ ACGTGGTCATTTCCCTAGAAGTGGAACCACTAATGTGCCCTCCCATGTTCTCAACCTCCT
JMFF004B05+ CT
                      ____________________________________________________________
consensus ACGTGGTCATTTCCCTAGAAGTGGAACCACTAATGTGCCCTCCCATGTTCTCAACCTCCT
 
. : . : . : . : . : . :
JMSF022J15+ CCTCAACGGCCTTGGGTAGCCGCTTCTCGGTCCCTTTGAAGATCAAATGCTCGAGAAAAT
JMFS119H07+ CCTCAACGGCCTTGGGTAGCCGCTTCTCGGTCCCTTTGAAGATCAAATGCTCGAGAAAAT
JMFF004B05+ CCTCAACGGCCTTGGGTAGCCGCTTCTCGGTCCCTTTGAAGATCAAATGCTCGAGAAAAT
                      ____________________________________________________________
consensus CCTCAACGGCCTTGGGTAGCCGCTTCTCGGTCCCTTTGAAGATCAAATGCTCGAGAAAAT
 
. : . : . : . : . : . :
JMSF022J15+ GCGCCACGCCGTTGTTGTCATCAGTCTCGAACCGAGACCCGGCGTCGATCGACACACCTA
JMFS119H07+ GCGCCACGCCGTTGTTGTCATCAGTCTCGAACCGAGACCCGGCGTCGATCGACACACCTA
JMFF004B05+ GCGCCACGCCGTTGTTGTCATCAGTCTCGAACCGAGACCCGGCGTCGATCGACACACCTA
JMSF004L06+ GTCGATCGACACACCTA
                      ____________________________________________________________
consensus GCGCCACGCCGTTGTTGTCATCAGTCTCGAACCGAGACCCGGCGTCGATCGACACACCTA
 
. : . : . : . : . : . :
JMSF022J15+ TGGCTGCGGTCTTCGCGGCGAGATTAGACTCGGTGGCCACACGTAAGCCGTTAGGGAGAG
JMFS119H07+ TGGCTGCGGTCTTCGCGGCGAGATTAGACTCGGTGGCCACACGTAAGCCGTTAGGGAGAG
JMFF004B05+ TGGCTGCGGTCTTCGCGGCGAGATTAGACTCGGTGGCCACACGTAAGCCGTTAGGGAGAG
JMSF004L06+ TGGCTGCCGTCTTCGCGGCGAGATTAGACTCGGTGGCCACACGTAAGCCGTTAGGGAGAG
                      ____________________________________________________________
consensus TGGCTGCGGTCTTCGCGGCGAGATTAGACTCGGTGGCCACACGTAAGCCGTTAGGGAGAG
 
. : . : . : . : . : . :
JMSF022J15+ TGGTGACTTTAGTCTCCGGGACGGAGAGGATCGAGGTGTGATCGGTTTGAATCGGGTGGG
JMFS119H07+ TGGTGACTTTAGTCTCCGGGACGGAGAGGATCGAGGTGTGATCGGTTTGAATCGGGTGGG
JMFF004B05+ TGGTGACTTTAGTCTCCGGGACGGAGAGGATCGAGGTGTGATCGGTTTGAATCGGGTGGG
JMSF004L06+ TGGTGACTTTAGTCTCCGGGACGGAGAGGATCGAGGTGTGATCGGTTTGAATCGGGTGGG
                      ____________________________________________________________
consensus TGGTGACTTTAGTCTCCGGGACGGAGAGGATCGAGGTGTGATCGGTTTGAATCGGGTGGG
 
. : . : . : . : . : . :
JMSF022J15+ GGGAATTGTGCTGGAGGAACCTCGGGTCGGGTGTCTCGAGTTTCCTGAGCTTGGATTTCA
JMFS119H07+ GGGAATTGTGCTGGAGGAACCTCGGGTCGGGTGTCTCGAGTTTCCTGAGCTTGGATTTCA
JMFF004B05+ GGGAATTGTGCTGGAGGAACCTCGGGTCGGGTGTCTCGAGTTTCCTGAGCTTGGATTTCA
JMSF004L06+ GGGAATTGTGCTGGAGGAACCTCGGGTCGGGTGTCTCGAGTTTCCTGAGCTTGGATTTCA
                      ____________________________________________________________
consensus GGGAATTGTGCTGGAGGAACCTCGGGTCGGGTGTCTCGAGTTTCCTGAGCTTGGATTTCA
 
. : . : . : . : . : . :
JMSF022J15+ CCCGCTCGGCTAAGCGATCGTAGATCATGAGGTCCGGAGGAGGTGGGGAGGGTGGTGCCG
JMFS119H07+ CCCGCTCGGCTAAGCGATCGTAGATCATGAGGTCCGGAGGAGGTGGGGAGGGTGGTGCCG
JMFF004B05+ CCCGCTCGGCTAAGCGATCGTAGATCATGAGGTCCGGAGGAGGTGGGGAGGGTGGTGCCG
JMSF015B20+ CTAAGCGATCGTAGATCATGAGGTCCGGAGGAGGTGGGGAGGGTGGTGCCG
JMSF004L06+ CCCGCTCGGCTAAGCGATCGTAGATCATGAGGTCCGGAGGAGGTGGGGAGGGTGGTGCCG
                      ____________________________________________________________
consensus CCCGCTCGGCTAAGCGATCGTAGATCATGAGGTCCGGAGGAGGTGGGGAGGGTGGTGCCG
 
. : . : . : . : . : . :
JMSF022J15+ GAGCTTCCGCAGCCTGAGCTAACTGGGAGGCGAAACGCGTGGGTTGAGTCAGGCATGGCG
JMFS119H07+ GAGCTTCCGCAGCCTGAGCTAACTGGGAGGCGAAACGCGTGGGTTGAGTCAGGCATGGCG
JMFF004B05+ GAGCTTCCGCAGCCTGAGCTAACTGGGAGGCGAAACGCGTGGGTTGAGTCAGGCATGGCG
JMSF015B20+ GAGCTTCCGCAGCCTGAGCTAACTGGGAGGCGAAACGCGTGGGTTGAGTCAGGCATGGCG
JMSF004L06+ GAGCTTCCGCAGCCTGAGCTAACTGGGAGGCGAAACGCGTGGGTTGAGTCAGGCATGGCG
                      ____________________________________________________________
consensus GAGCTTCCGCAGCCTGAGCTAACTGGGAGGCGAAACGCGTGGGTTGAGTCAGGCATGGCG
 
. : . : . : . : . : . :
JMSF022J15+ CAGTCAGGTGCCGAGAGCGGCGCGTGAAAGAAAAGAGGTGGCGCGTTGTCATTCCTCCGT
JMFS119H07+ CAGTCAGGTGCCGAGAGCGGCGCGTGAAAGAAAAGAGGTGGCGCGTTGTCATTCCTCCGT
JMFF004B05+ CAGTCAGGTGCCGAGAGCGGCGCGTGAAAGAAAAGAGGTGGCGCGTTGTCATTCCTCCGT
JMSF015B20+ CAGTCAGGTGCCGAGAGCGGCGCGTGAAAGAAAAGAGGTGGCGCGTTGTCATTCCTCCGT
JMSF004L06+ CAGTCAGGTGCCGAGAGCGGCGCGTGAAAGAAAAGAGGTGGCGCGTTGTCATTCCTCCGT
                      ____________________________________________________________
consensus CAGTCAGGTGCCGAGAGCGGCGCGTGAAAGAAAAGAGGTGGCGCGTTGTCATTCCTCCGT
 
. : . : . : . : . : . :
JMSF022J15+ TGTTCCAATTCGAGCTGTTTTTTCAGTTGAGC
JMFS119H07+ TGTTCCAATTCGAGCTGTTTTTTCAGTTGAGCGACGGA
JMFF004B05+ TGTTCCAATTCGAGCTGTTTTTTCAGTTGAGCGACGGAGATGAGAATGGAGAAGAAGA
JMSF015B20+ TGTTCCAATTCGAGCTGTTTTTTCAGTTGAGCGACGGAGATGAGAATGGAGAAGAAGA
JMSF004L06+ TGTTCCAATTCGAGCTGTTTTTTCAGTTGAGCGACGGAGATGAGAATGGAGAAGAAGATC
                      ____________________________________________________________
consensus TGTTCCAATTCGAGCTGTTTTTTCAGTTGAGCGACGGAGATGAGAATGGAGAAGAAGATC