Previous Contig 004626:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003A20Sequence320004626 (4)737012235 (3)gb:AY090445_15741342e-64Arabidopsis thaliana At1g79720/F19K16_30 mRNA, complete cds.>gb:AK117694_1815715
JMSF004I24Sequence304004626 (4)
JMSF022B20Sequence648004626 (4)gb:AY090445_15741341e-21Arabidopsis thaliana At1g79720/F19K16_30 mRNA, complete cds.>gb:AK117694_1815715721012235 (3)gb:AY090445_15741341e-55Arabidopsis thaliana At1g79720/F19K16_30 mRNA, complete cds.>gb:AK117694_1815715
JMSF039B11Sequence683004626 (4)gb:AY090445_15741347e-39Arabidopsis thaliana At1g79720/F19K16_30 mRNA, complete cds.>gb:AK117694_1815715662012235 (3)gb:AY090445_15741341e-52Arabidopsis thaliana At1g79720/F19K16_30 mRNA, complete cds.>gb:AK117694_1815715

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039B11+ CGTCGCAAACTGC
                      ____________________________________________________________
consensus CGTCGCAAACTGC
 
. : . : . : . : . : . :
JMSF039B11+ AAAGACTGACAGGCCGAGGCATTGCACGGGACCGAGAGATAAGAAGGGGACATTGAGGGG
                      ____________________________________________________________
consensus AAAGACTGACAGGCCGAGGCATTGCACGGGACCGAGAGATAAGAAGGGGACATTGAGGGG
 
. : . : . : . : . : . :
JMSF039B11+ TTAAAGAGAGGCTGTGGTTGACTATAACATGATCTGCAAGGCTGGCATTGGACCCATGTT
JMSF022B20+ CCATGTT
                      ____________________________________________________________
consensus TTAAAGAGAGGCTGTGGTTGACTATAACATGATCTGCAAGGCTGGCATTGGACCCATGTT
 
. : . : . : . : . : . :
JMSF039B11+ AGGTCACTCCCTGTATCAACAATTACTGTCATGTTTCTCCTGCCTATGCTTATGGTCACA
JMSF022B20+ AGGTCACTCCCTGTATCAACAATTACTGTCATGTTTCTCCTGCCTATGCTTATGGTCACA
                      ____________________________________________________________
consensus AGGTCACTCCCTGTATCAACAATTACTGTCATGTTTCTCCTGCCTATGCTTATGGTCACA
 
. : . : . : . : . : . :
JMSF039B11+ ATGTAGTTTAGAGTCTGTAGTTTGAAACCAGAAGTGATTGGTGTCTGGGCTTGTTCTGAA
JMSF022B20+ ATGTAGTTTAGAGTCTGTAGTTTGAAACCAGAAGTGATTGGTGTCTGGGCTTGTTCTGAA
                      ____________________________________________________________
consensus ATGTAGTTTAGAGTCTGTAGTTTGAAACCAGAAGTGATTGGTGTCTGGGCTTGTTCTGAA
 
. : . : . : . : . : . :
JMSF039B11+ CCCTCAATTTTCTTTCTGGAAATAGCATTCTTGATGTGGGATTGTATCGATCGTACCCGA
JMSF022B20+ CCCTCAATTTTCTTTCTGGAAATAGCATTCTTGATGTGGGATTGTATCGATCGTACCCGA
                      ____________________________________________________________
consensus CCCTCAATTTTCTTTCTGGAAATAGCATTCTTGATGTGGGATTGTATCGATCGTACCCGA
 
. : . : . : . : . : . :
JMSF039B11+ ATTTCATCATCTGCCAGGCTTTTCTTCTGCCATTCTTCCCAGTTCTTTACTGCCCCAGAA
JMSF022B20+ ATTTCATCATCTGCCAGGCTTTTCTTCTGCCATTCTTCCCAGTTCTTTACTGCCCCAGAA
                      ____________________________________________________________
consensus ATTTCATCATCTGCCAGGCTTTTCTTCTGCCATTCTTCCCAGTTCTTTACTGCCCCAGAA
 
. : . : . : . : . : . :
JMSF039B11+ CACAAGCCCTTGTGCTTCATCTCCAAAATGGTTGCCCCATTTTCTTTCCTTGATTTCTGG
JMSF003A20+ TCTGG
JMSF022B20+ CACAAGCCCTTGTGCTTCATCTCCAAAATGGTTGCCCCATTTTCTTTCCTTGATTTCTGG
                      ____________________________________________________________
consensus CACAAGCCCTTGTGCTTCATCTCCAAAATGGTTGCCCCATTTTCTTTCCTTGATTTCTGG
 
. : . : . : . : . : . :
JMSF039B11+ GATGAACAACTTGGGTTAAGGTTGTACCCTTTCCTCCATGTTCTGGGTTGGAGTTTTTTC
JMSF003A20+ GATGAACAACTTGGGTTAAGGTTGTACCCTTTCCTCCATGTTCTGGGTTGGAGTTTTTTC
JMSF022B20+ GATGAACAACTTGGGTTAAGGTTGTACCCTTTCCTCCATGTTCTGGGTTGGAGTTTTTTC
                      ____________________________________________________________
consensus GATGAACAACTTGGGTTAAGGTTGTACCCTTTCCTCCATGTTCTGGGTTGGAGTTTTTTC
 
. : . : . : . : . : . :
JMSF039B11+ AACGGAAAAACTACCTGTTTCTCTCCATAACTGTCAACAGAATCACCAGAAGTAGTAAGC
JMSF003A20+ AACGGAAAAACTACCTGTTTCTCTCCATAACTGTCAACAGAATCACCAGAAGTAGTAAGC
JMSF022B20+ AACGGAAAAACTACCTGTTTCTCTCCATAACTGTCAACAGAATCACCAGAAGTAGTAAGC
JMSF004I24+ GGAAAAACTACCTGTTTCTCTCCATAACTGTCAACAGAATCACCAGAAGTAGTAAGC
                      ____________________________________________________________
consensus AACGGAAAAACTACCTGTTTCTCTCCATAACTGTCAACAGAATCACCAGAAGTAGTAAGC
 
. : . : . : . : . : . :
JMSF039B11+ ACAAGCAGCAGAAGGAGAAAACCAAGAAATGATGACCACAATGACATTTTCAACAGAGCT
JMSF003A20+ ACAAGCAGCAGAAGGAGAAAACCAAGAAATGATGACCACAATGACATTTTCAACAGAGCT
JMSF022B20+ ACAAGCAGCAGAAGGAGAAAACCAAGAAATGATGACCACAATGACATTTTCAACAGAGCT
JMSF004I24+ ACAAGCAGCAGAAGGAGAAAACCAAGAAATGATGACCACAATGACATTTTCAACAGAGCT
                      ____________________________________________________________
consensus ACAAGCAGCAGAAGGAGAAAACCAAGAAATGATGACCACAATGACATTTTCAACAGAGCT
 
. : . : . : . : . : . :
JMSF039B11+ TAGCAAGCTTGTAGTGCATATACTTATTATGCAAAACTATTGAGAGAAAGATGGTAATAT
JMSF003A20+ TAGCAAGCTTGTAGTGCATATACTTATTATGCAAAACTATTGAGAGAAAGATGGTAATAT
JMSF022B20+ TAGCAAGCTTGTAGTGCATATACTTATTATGCAAAACTATTGAGAGAAAGATGGTAATAT
JMSF004I24+ TAGCAAGCTTGTAGTGCATATACTTATTATGCAAAACTATTGAGAGAAAGATGGTAATAT
                      ____________________________________________________________
consensus TAGCAAGCTTGTAGTGCATATACTTATTATGCAAAACTATTGAGAGAAAGATGGTAATAT
 
. : . : . : . : . : . :
JMSF039B11+ TAATAACTC
JMSF003A20+ TAATAACTCAAAGAATAATGTGTTTTGGGGGACTATTAATCTTGAAAATAATGAAGAGAG
JMSF022B20+ TAATAACTCAAAGAATAATGTGTTTTGGGGGACTATTAATCTTGAAAATAATGAAGAGAG
JMSF004I24+ TAATAACTCAAAGAATAATGTGTTTTGGGGGACTATTAATCTTGAAAATAATGAAGAGAG
                      ____________________________________________________________
consensus TAATAACTCAAAGAATAATGTGTTTTGGGGGACTATTAATCTTGAAAATAATGAAGAGAG
 
. : . : . : . : . : . :
JMSF003A20+ AAAAGAGGATGAAT
JMSF022B20+ AAAAGAGGATGAATAAGGAGAAGGGAGAGGAGAGATTCTT
JMSF004I24+ AAAAGAGGATGAATAAGGAGAAGGGAGAGGAGAGATTCTTGGGAGTTGGAAGTAGGCATC
                      ____________________________________________________________
consensus AAAAGAGGATGAATAAGGAGAAGGGAGAGGAGAGATTCTTGGGAGTTGGAAGTAGGCATC