Previous Contig 004624:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS099F02Sequence612004624 (3)
JMFS110G02Sequence617004624 (3)
JMSF004I17Sequence396004624 (3)346013150 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS099F02+ TAGTCACCCTCATCCTTAACTTTCCTGGGTCTAAGTGTCCGTGAA
                      ____________________________________________________________
consensus TAGTCACCCTCATCCTTAACTTTCCTGGGTCTAAGTGTCCGTGAA
 
. : . : . : . : . : . :
JMFS099F02+ CCCTCTGTAATTTCCTTTACTTTCTCTTCTTCACCATCTTCTTCTCCTCTTCTTTCTTCA
                      ____________________________________________________________
consensus CCCTCTGTAATTTCCTTTACTTTCTCTTCTTCACCATCTTCTTCTCCTCTTCTTTCTTCA
 
. : . : . : . : . : . :
JMFS099F02+ TGTTTAGCCCTTTTCCCTCGATTCCTCCTTTTATCTTCAGCATGGCCCTCATTGTCCAAT
                      ____________________________________________________________
consensus TGTTTAGCCCTTTTCCCTCGATTCCTCCTTTTATCTTCAGCATGGCCCTCATTGTCCAAT
 
. : . : . : . : . : . :
JMFS099F02+ ATCTTTTTCTTCCTACCCCTGTTCCTACTGACCTCTTTGTCTGCTTCATCCCACTCCATC
                      ____________________________________________________________
consensus ATCTTTTTCTTCCTACCCCTGTTCCTACTGACCTCTTTGTCTGCTTCATCCCACTCCATC
 
. : . : . : . : . : . :
JMFS099F02+ ATTTGTTCCTTGAGTTCCCCAATCTTCTCAATCGCCTTCTGACTTGACAGCCTCCTTGGA
                      ____________________________________________________________
consensus ATTTGTTCCTTGAGTTCCCCAATCTTCTCAATCGCCTTCTGACTTGACAGCCTCCTTGGA
 
. : . : . : . : . : . :
JMFS099F02+ AATGCCCTTGCATGAGATTTGCAACCCTCATTCTCCTCCTCTTCTTCACCACCTGCCGCC
                      ____________________________________________________________
consensus AATGCCCTTGCATGAGATTTGCAACCCTCATTCTCCTCCTCTTCTTCACCACCTGCCGCC
 
. : . : . : . : . : . :
JMFS099F02+ TTTCCCTTTTCAATGTCCATTAGCTCTGCACAATCCTCATCCTCTTTTTTATTTCCACCC
                      ____________________________________________________________
consensus TTTCCCTTTTCAATGTCCATTAGCTCTGCACAATCCTCATCCTCTTTTTTATTTCCACCC
 
. : . : . : . : . : . :
JMFS099F02+ ACTTCTTCCTCATTCTCCGTATTCATTAGCTCCTCTTGCCCATGACCTTGACTGTCATTT
JMFS110G02+ TTCATTAGCTCCTCTTGCCCATGACCTTGACTGTCATTT
                      ____________________________________________________________
consensus ACTTCTTCCTCATTCTCCGTATTCATTAGCTCCTCTTGCCCATGACCTTGACTGTCATTT
 
. : . : . : . : . : . :
JMFS099F02+ TCCTGTGTTTTAGCATTACAGAGCTTATTCTTCTTCACTGAATCCCCGCTTTCCATTTCT
JMFS110G02+ TCCTGTGTTTAAGCAATACAGAGCTTATTCTTCTTCACTGAATCCCCGCTTTCCATTTCT
                      ____________________________________________________________
consensus TCCTGTGTTTTAGCATTACAGAGCTTATTCTTCTTCACTGAATCCCCGCTTTCCATTTCT
 
. : . : . : . : . : . :
JMFS099F02+ TTCTCAACCTTTATTCCTGCTCCCGCTTCACCATTTTCATCTGGTATAAATTCGCTATCC
JMFS110G02+ TTCTCAACCTTTATTCCTGCTCCCGCTTCACCATTTTCATCTGGTATAAATTCGCTATCC
                      ____________________________________________________________
consensus TTCTCAACCTTTATTCCTGCTCCCGCTTCACCATTTTCATCTGGTATAAATTCGCTATCC
 
. : . : . : . : . : . :
JMFS099F02+ CAGCCCTTCCCACCGGACTTATTCTTC
JMFS110G02+ CAGCCCTTCCCACCGGACTTATTCTTCTTATTCACTGAACCCCCGTTTTCCCCTTCAATC
                      ____________________________________________________________
consensus CAGCCCTTCCCACCGGACTTATTCTTCTTATTCACTGAACCCCCGTTTTCCCCTTCAATC
 
. : . : . : . : . : . :
JMFS110G02+ TCAGCCCCCATTCCAATTCCCTCTTCACCGCCATCCACTGGAATTTTGTTTATTTTCTGG
JMSF004I17+ TCACCGCCATCCACTGGAATTTGGTTTATTTTCTGG
                      ____________________________________________________________
consensus TCAGCCCCCATTCCAATTCCCTCTTCACCGCCATCCACTGGAATTTTGTTTATTTTCTGG
 
. : . : . : . : . : . :
JMFS110G02+ TGACTCATACCGGAAATTTTCTCCTCTGCTACAGCTACAGCTCCAGTTTCTTCACTATTC
JMSF004I17+ TGACTCATACCGGAAATTTTCTCCTCTGCTACAGCTACAGCTCCAGTTTCTTCACTATTC
                      ____________________________________________________________
consensus TGACTCATACCGGAAATTTTCTCCTCTGCTACAGCTACAGCTCCAGTTTCTTCACTATTC
 
. : . : . : . : . : . :
JMFS110G02+ TCTTTCCCGGACTCCGAATTTTCCTCGCTTTCCTTGAAACCCGCGCCCTTCTCGGCCGGA
JMSF004I17+ TCTTTCCCGGACTCCGAATTTTCCTCGCTTTCCTTGAAACCCGCGCCCTTCTCGGCCGGA
                      ____________________________________________________________
consensus TCTTTCCCGGACTCCGAATTTTCCTCGCTTTCCTTGAAACCCGCGCCCTTCTCGGCCGGA
 
. : . : . : . : . : . :
JMFS110G02+ TTACTACGCTTCTTCGTCGGTTCTCCTTTTTTACATGATTGCTGCTGAAGCTCCAAGGAG
JMSF004I17+ TTACTACGCTTCTTCGTCGGTTCTCCTTTTTTACATGATTGCTGCTGAAGCTCCAAGGAG
                      ____________________________________________________________
consensus TTACTACGCTTCTTCGTCGGTTCTCCTTTTTTACATGATTGCTGCTGAAGCTCCAAGGAG
 
. : . : . : . : . : . :
JMFS110G02+ TCGTCTTCCCCAAATTCCCGATCATCTTTTTCAATCTCCATATCATCCGTCACTGAGACT
JMSF004I17+ TCGTCTTCCCCAAATTCCCGATCATCTTTTTCAATCTCCATATCATCCGTCACTGAGACT
                      ____________________________________________________________
consensus TCGTCTTCCCCAAATTCCCGATCATCTTTTTCAATCTCCATATCATCCGTCACTGAGACT
 
. : . : . : . : . : . :
JMFS110G02+ CCCTTCTCCGACATGGCATCGGCCTTATTGTTTCCGATCACCGTTTATTGTCCTTGATAA
JMSF004I17+ CCCTTCTCCGACATGGCATCGGCCTTATTGTTTCCGATCACCGTTTATTGTCCTTGATAA
                      ____________________________________________________________
consensus CCCTTCTCCGACATGGCATCGGCCTTATTGTTTCCGATCACCGTTTATTGTCCTTGATAA
 
. : . : . : . : . : . :
JMFS110G02+ CCCGATTATTCCTCGCGTTTCACCACTCCCCCAGAGAA
JMSF004I17+ CCCGATTATTCCTCGCGTTTCACCACTCCCCCAGAGAATCTTCCCCCTTTTACCTTGTTC
                      ____________________________________________________________
consensus CCCGATTATTCCTCGCGTTTCACCACTCCCCCAGAGAATCTTCCCCCTTTTACCTTGTTC