Previous Contig 004622:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005M15Sequence584004622 (5)gb:AY247272_15925978e-47Medicago truncatula AKIN beta2 mRNA, complete cds.691004622 (5)gb:AF322108_17860691e-73Lycopersicon esculentum SNF1-related kinase complex anchoring protein SIP1 mRNA,
JMFF017I10Sequence527004622 (5)gb:AY247272_15925972e-38Medicago truncatula AKIN beta2 mRNA, complete cds.326000750 (12)gb:AF322108_17860692e-27Lycopersicon esculentum SNF1-related kinase complex anchoring protein SIP1 mRNA,
JMFN004C10Sequence180004622 (5)
JMSF004I12Sequence436004622 (5)gb:AY247272_15925978e-16Medicago truncatula AKIN beta2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005M15- GTAGTGTGACAATTGCAGATGATGATGGATCGATCGAA
                      ____________________________________________________________
consensus GTAGTGTGACAATTGCAGATGATGATGGATCGATCGAA
 
. : . : . : . : . : . :
rJMFF005M15- GCTGAGGCTCGGGATTCTCATCTCTCTATGGACTTGTACAGCACCACGGTGACGTATTTG
                      ____________________________________________________________
consensus GCTGAGGCTCGGGATTCTCATCTCTCTATGGACTTGTACAGCACCACGGTGACGTATTTG
 
. : . : . : . : . : . :
rJMFF005M15- GAGAGGAACCTATGAGTAGAACCGAGTGCAACCACTGACGGGGTGCTTCTACCCCTCTGC
                      ____________________________________________________________
consensus GAGAGGAACCTATGAGTAGAACCGAGTGCAACCACTGACGGGGTGCTTCTACCCCTCTGC
 
. : . : . : . : . : . :
rJMFF005M15- ATGTAGAGATGATTAAGCACAACGTGCTGAGGCCTCGAGAACGGAGGCGGGATTTCTGAA
                      ____________________________________________________________
consensus ATGTAGAGATGATTAAGCACAACGTGCTGAGGCCTCGAGAACGGAGGCGGGATTTCTGAA
 
. : . : . : . : . : . :
rJMFF005M15- TGAGATGATGGAACATTAAGCAAGGTTAACTGAAGATGGGGAGGTACTAAAGGCGGCTCC
                      ____________________________________________________________
consensus TGAGATGATGGAACATTAAGCAAGGTTAACTGAAGATGGGGAGGTACTAAAGGCGGCTCC
 
. : . : . : . : . : . :
rJMFF005M15- TTGGCATAGTCCTCGGCTCCAAGTTGGAGGCTGCTGTAACTTGAATCCGGGGATAGAGGA
                      ____________________________________________________________
consensus TTGGCATAGTCCTCGGCTCCAAGTTGGAGGCTGCTGTAACTTGAATCCGGGGATAGAGGA
 
. : . : . : . : . : . :
rJMFF005M15- GGCTCAAAGCCAGAGATGCTCTGAATGTCTTCCGGAACATACTCCTGCAAATCCAAGACA
                      ____________________________________________________________
consensus GGCTCAAAGCCAGAGATGCTCTGAATGTCTTCCGGAACATACTCCTGCAAATCCAAGACA
 
. : . : . : . : . : . :
rJMFF005M15- TTGTAATAATTTCCAGCTTCATCAGTGATCCACGCGACATCAGGGGAATACCTCCATTGT
JMFF017I10+ TGT
JMFF005M15+ TTGTAATAATTTCCAGCTTCATCAGTGATCCACGCGACATCAGGGGAATACCTCCATTGT
                      ____________________________________________________________
consensus TTGTAATAATTTCCAGCTTCATCAGTGATCCACGCGACATCAGGGGAATACCTCCATTGT
 
. : . : . : . : . : . :
rJMFF005M15- CCATCAACTATAAACCTATACTGATAAACTCCTGAAGGGAGCACTTTCATAATGGTGAAA
JMFF017I10+ CCATCAACTATAAACCTATACTGATAAACTCCTGAAGGGAGCACTTTCATAATGGTGAAA
JMFF005M15+ CCATCAACTATAAACCTATACTGATAAACTCCTGAAGGGAGCACTTTCATAATGGTGAAA
                      ____________________________________________________________
consensus CCATCAACTATAAACCTATACTGATAAACTCCTGAAGGGAGCACTTTCATAATGGTGAAA
 
. : . : . : . : . : . :
rJMFF005M15- TCTTTTCCTGACCTCTGCAAAGGCTTCCTGATAAAAGAGTTTCTAGAGATCTAAGTCCCT
JMFF017I10+ TCTTTTCCTGACCTCTGCAAAGGCTTCCTGATAAAAGAGTTTCTAGACNTCTAAGTCCCT
JMFF005M15+ TCTTTTCCTGACCTCTGCAAAGGCTTCCTGATAAAAGAGTTTCTAGAGATCTAAGTCCCT
                      ____________________________________________________________
consensus TCTTTTCCTGACCTCTGCAAAGGCTTCCTGATAAAAGAGTTTCTAGAGATCTAAGTCCCT
 
. : . : . : . : . : . :
rJMFF005M15- TGTTTTCCAATCATCCCATGACCCCTCCACAGAAACTTCCTTGCCACCATGGCCCCAGAT
JMFF017I10+ TGTTTTCCAATCATCCCATGACCCCTCCACAGAAACTTCCTTGCCACCATGGCCCCAGAT
JMFF005M15+ TGTTTTCCAATCATCCCATGACCCCTCCACAGAAACTTCCTTGCCACCATGGCCCCAGAT
JMSF004I12+ CACCATGGCCCCAGAT
                      ____________________________________________________________
consensus TGTTTTCCAATCATCCCATGACCCCTCCACAGAAACTTCCTTGCCACCATGGCCCCAGAT
 
. : . : . : . : . : . :
rJMFF005M15- TATCACTGTCGGAACCCTTTGCTCATCATACATGTCATCATATCCAGATGCAG
JMFF017I10+ TATCACTGTCGGAACCCTTTGCTCATCATACATGTCATCATATCCAGATGCAGTTTGCAT
JMFF005M15+ TATCACTGTCGGAACCCTTTGCTCATCATACATGTCATCATATCCAGATGCAGTTTGCAT
JMSF004I12+ NATCACTGTCGGAACCCTTTGCTCATCATACANGTCATCATATCCAGATGCAGTTTGCAT
                      ____________________________________________________________
consensus TATCACTGTCGGAACCCTTTGCTCATCATACATGTCATCATATCCAGATGCAGTTTGCAT
 
. : . : . : . : . : . :
JMFF017I10+ CCATGGAGGGTTTGGGATGTGCAACTCATCAGGTCTTTGTAGAGGAACCACTGGCATCTG
JMFF005M15+ CCATGGAGGGTTTGGGATGTGCAACTCATCAGGTCTTTGTAGAGGAACCACTGGCATCTG
JMSF004I12+ CCATGGAGGGTTTGGGATGTGCAACTCATCAGGTCTTTGTAGAGGAACCACTGGCATCTG
                      ____________________________________________________________
consensus CCATGGAGGGTTTGGGATGTGCAACTCATCAGGTCTTTGTAGAGGAACCACTGGCATCTG
 
. : . : . : . : . : . :
JMFF017I10+ AGGTCGGAACATCAAAGGGGAACGAGAAGCCCTAGGGCTGGAAGGTGGAGACTGACCCAT
JMFN004C10+ CCAT
JMFF005M15+ AGGTCGGAACATCAAAGGGGAACGAGAAGCCCTAGGGCTGGAAGGTGGAGACTGACCCAT
JMSF004I12+ AGGTCGGAACATCAAAGGGGAACGAGAAGCCCTAGGGCTGGAAGGTGGAGACTGACCCAT
                      ____________________________________________________________
consensus AGGTCGGAACATCAAAGGGGAACGAGAAGCCCTAGGGCTGGAAGGTGGAGACTGACCCAT
 
. : . : . : . : . : . :
JMFF017I10+ GAACTCACCATCCATCTGCGCACTATCCGGCGCCTCACCGCCACCGCCGGCGGCGCCACT
JMFN004C10+ GAACTCACCATCCATCTGCGCACTATCCGGCGCCTCACCGCCACCGCCGGCGGCGCCACT
JMFF005M15+ GAACTCACCATCCATCTGCGCACTATCCGGCGCCTCACCGCCACCGCCGGCGGCGCCACT
JMSF004I12+ GAACTCACCATCCATCTGCGCACTATCCGGCGCCTCACCGCCACCGCCGGCGGCGCCACT
                      ____________________________________________________________
consensus GAACTCACCATCCATCTGCGCACTATCCGGCGCCTCACCGCCACCGCCGGCGGCGCCACT
 
. : . : . : . : . : . :
JMFF017I10+ CTCTTCAGCTCTGGACGGGCTGTTGCCACCACCGCCATCTTCTTCTCTCCCATTAACATT
JMFN004C10+ CTCTTCAGCTCTGGACGGGCTGTTGCCACCACCGCCATCTTCTTCTCTCCCATTAACATT
JMFF005M15+ CTCTTCAGCTCTGGACGGGCTGTTGCCACCACCGCCATCTTCTTCTCTCCCATTAACATT
JMSF004I12+ CTCTTCAGCTCTGGACGGGCTGTTGCCACCACCGCCATCTTCTTCTCTCCCATTAACATT
                      ____________________________________________________________
consensus CTCTTCAGCTCTGGACGGGCTGTTGCCACCACCGCCATCTTCTTCTCTCCCATTAACATT
 
. : . : . : . : . : . :
JMFF017I10+ CCCCATTTTTATTCAGCACGAAAAAGCGACTCGCCTTAGAATCT
JMFN004C10+ CCCCA-TTTTATTCAGCACGAAAA
JMFF005M15+ CCCCATTTTTATTCAGCACGAAAAAGCGACTCGCCTTAGAATCT
JMSF004I12+ CCCCATTTTTATTCAGCACGAAAAAGCGACTCGCCTTAGAATCTAAACAATCAGATTCCT
                      ____________________________________________________________
consensus CCCCATTTTTATTCAGCACGAAAAAGCGACTCGCCTTAGAATCTAAACAATCAGATTCCT
 
. : . : . : . : . : . :
JMSF004I12+ TGTTGTTGTATATATATAAATATATACTATACAGCATACAGTATTACATATACTTCTCCC
                      ____________________________________________________________
consensus TGTTGTTGTATATATATAAATATATACTATACAGCATACAGTATTACATATACTTCTCCC