Previous Contig 004621:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027I05Sequence527004621 (4)gb:AY057663_15640767e-41Arabidopsis thaliana AT3g14930/K15M2_7 mRNA, complete cds.716011032 (3)gb:AY136476_15819769e-87Arabidopsis thaliana putative uroporphyrinogen decarboxylase (At3g14930) mRNA, c
JMFF050N12Sequence597004621 (4)gb:AY057663_15640761e-50Arabidopsis thaliana AT3g14930/K15M2_7 mRNA, complete cds.436011032 (3)gb:AY136476_15819763e-23Arabidopsis thaliana putative uroporphyrinogen decarboxylase (At3g14930) mRNA, c
JMSF004I11Sequence349004621 (4)gb:AY057663_15640760.005Arabidopsis thaliana AT3g14930/K15M2_7 mRNA, complete cds.
JMSF049K13Sequence666004621 (4)gb:AY057663_15640763e-61Arabidopsis thaliana AT3g14930/K15M2_7 mRNA, complete cds.725011032 (3)gb:AY136476_15819762e-91Arabidopsis thaliana putative uroporphyrinogen decarboxylase (At3g14930) mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049K13+ ACTGCAGCTTGCTCCCCGACCTCTTTACGCAAAAT
                      ____________________________________________________________
consensus ACTGCAGCTTGCTCCCCGACCTCTTTACGCAAAAT
 
. : . : . : . : . : . :
JMFF050N12+ TCCAAATCAATAGAGTGCAAAGTTCTCAA
JMSF049K13+ CTTGAGGGAGTTCCCCACAAACTGTAGCTTTTCCAAATCAATAGAGTGCAAAGTTCTCAA
                      ____________________________________________________________
consensus CTTGAGGGAGTTCCCCACAAACTGTAGCTTTTCCAAATCAATAGAGTGCAAAGTTCTCAA
 
. : . : . : . : . : . :
JMFF050N12+ TCCCTCCTCAGAACGAATGGGAGACTGAATCACAGGACCACGAACCTCTTCAATGTCAAA
JMSF049K13+ TCCCTCCTCAGAACGAATGGGAGACTGAATCACAGGACCACGAACCTCTTCAATGTCAAA
JMFF027I05+ CCTCTTCAATGTCAAA
                      ____________________________________________________________
consensus TCCCTCCTCAGAACGAATGGGAGACTGAATCACAGGACCACGAACCTCTTCAATGTCAAA
 
. : . : . : . : . : . :
JMFF050N12+ TTGGACTCCAAATGCAGGAAGTGGGGTTAATATGTCAGAGAAGATGATTACTCCATCAGG
JMSF049K13+ TTGGACTCCAAATGCAGGAAGTGGGGTTAATATGTCAGAGAAGATGATTACTCCATCAGG
JMFF027I05+ TTGGACTCCAAATGCAGGAAGTGGGGTTAATATGTCAGAGAAGATGATTACTCCATCAGG
                      ____________________________________________________________
consensus TTGGACTCCAAATGCAGGAAGTGGGGTTAATATGTCAGAGAAGATGATTACTCCATCAGG
 
. : . : . : . : . : . :
JMFF050N12+ ATGAAAAGCTTCCCAAGGCTGCAAAGAAATTTCGACAATGAGATCAGTTGTCTCTGACCT
JMSF049K13+ ATGAAAAGCTTCCCAAGGCTGCAAAGAAATTTCGACAATGAGATCAGTTGTCTCTGACCT
JMFF027I05+ ATGAAAAGCTTCCCAAGGCTGCAAAGAAATTTCGACAATGAGATCAGTTGTCTCTGACCT
                      ____________________________________________________________
consensus ATGAAAAGCTTCCCAAGGCTGCAAAGAAATTTCGACAATGAGATCAGTTGTCTCTGACCT
 
. : . : . : . : . : . :
JMFF050N12+ CTCTCTGAAGGATGGGTGTTTCTCTGCAAGCTTTCTGTAAACAGCCATATACCTTCCTGC
JMSF049K13+ CTCTCTGAAGGATGGGTGTTTCTCTGCAAGCTTTCTGTAAACAGCCATATACCTTCCTGC
JMFF027I05+ CTCTCTGAAGGATGGGTGTTTCTCTGCAAGCTTTCTGTAAACAGCCATATACCTTCCTGC
                      ____________________________________________________________
consensus CTCTCTGAAGGATGGGTGTTTCTCTGCAAGCTTTCTGTAAACAGCCATATACCTTCCTGC
 
. : . : . : . : . : . :
JMFF050N12+ TTGACGCATCATCCAAGCTGGTGGGCGACTAACACGTTCTCTTCTTGCTGCCCTCACCAA
JMSF049K13+ TTGACGCATCATCCAAGCTGGTGGGCGACTAACACGTTCTCTTCTTGCTGCCCTCACCAA
JMFF027I05+ TTGACGCATCATCCAAGCTGGTGGGCGACTAACACGTTCTCTTCTTGCTGCCCTCACCAA
JMSF004I11+ TCCAAGCTGGTGGGCGACTAACACGTTCTNTTCTTGCTGCCCTCACCAA
                      ____________________________________________________________
consensus TTGACGCATCATCCAAGCTGGTGGGCGACTAACACGTTCTCTTCTTGCTGCCCTCACCAA
 
. : . : . : . : . : . :
JMFF050N12+ AAGTGGTTCTGAAGAAGAAGAGGAGGAGGAGGCGCACGCCCGTATGAACTTTGCGGGTTT
JMSF049K13+ AAGTGGTTCTGAAGAAGAAGAGGAGGAGGAGGCGCACGCCCGTATGAACTTTGCGGGTTT
JMFF027I05+ AAGTGGTTCTGAAGAAGAAGAGGAGGAGGAGGCGCACGCCCGTATGAACTTTGCGGGTTT
JMSF004I11+ AAGTGGTTCTGAAGAAGAAGAGGAGGAGGAGGCGCACGCCCGTATGAACTTTGCGGGTTT
                      ____________________________________________________________
consensus AAGTGGTTCTGAAGAAGAAGAGGAGGAGGAGGCGCACGCCCGTATGAACTTTGCGGGTTT
 
. : . : . : . : . : . :
JMFF050N12+ ACGGGAGGTCCGAATTGCGTTCAACCCATTGGGGATAAACCCTAATTGGGAAAGCGAGCT
JMSF049K13+ ACGGGAGGTCCGAATTGCGTTCAACCCATTGGGGATAAACCCTAATTGGGAAAGCGAGCT
JMFF027I05+ ACGGGAGGTCCGAATTGCGTTCAACCCATTGGGGATAAACCCTAATTGGGAAAGCGAGCT
JMSF004I11+ ACGGGAGGTCCGAATTGCGTTCAACCCATTGGGGATAAACCCTAATTGGGAAAGCGAGCT
                      ____________________________________________________________
consensus ACGGGAGGTCCGAATTGCGTTCAACCCATTGGGGATAAACCCTAATTGGGAAAGCGAGCT
 
. : . : . : . : . : . :
JMFF050N12+ TGAAGATTTCCAGCCCAGAGCGGGTGTCCCATAGCTACTGCTACACCCACTCGTTGCCAT
JMSF049K13+ TGAAGATTTCCAGCCCAGAGCGGGTGTCCCATAGCTACTGCTACACCCACTCGTTGCCAT
JMFF027I05+ TGAAGATTTCCAGCCCAGAGCGGGTGTCCCATAGCTACTGCTACACCCACTCGTTGCCAT
JMSF004I11+ TGAAGATTTCCAGCCCAGAGCGGGTGTCCCATAGCTACTGCTACACCCACTCGTTGCCAT
                      ____________________________________________________________
consensus TGAAGATTTCCAGCCCAGAGCGGGTGTCCCATAGCTACTGCTACACCCACTCGTTGCCAT
 
. : . : . : . : . : . :
JMFF050N12+ TAACACAGAGAAACCCATCTCAGCTTCTTCTGAACAGGGAAAGGGTCGAGAATCCCCAAC
JMSF049K13+ TAACACAGAGAAACCCATCTCAGCTTCTTCTGAACAGGGAAAGGGTCGAGAATCCCCAAC
JMFF027I05+ TAACACAGAGAAACCCATCTCAGCTTCTTCTGAACAGGGAAAGGGTCGAGAATCCCCAAC
JMSF004I11+ TAACACAGAGAAACCCATCTCAGCTTCTTCTGAACAGGGAAAGGGTCGAGAATCCCCAAC
                      ____________________________________________________________
consensus TAACACAGAGAAACCCATCTCAGCTTCTTCTGAACAGGGAAAGGGTCGAGAATCCCCAAC
 
. : . : . : . : . : . :
JMFF050N12+ CCCAGCTTCTTATCTTCCCACTTTAATC
JMSF049K13+ CCCAGCTTCTTATCTTCCCACTTCAATC
JMFF027I05+ CCCAGCTTCTTATCTTCCCACTTCAATC
JMSF004I11+ CCCAGCTTCTTATCTTCCCACTTCAATCGCTGTGTTTTGGCCTTTGGCCTTTGGCCTTCC
                      ____________________________________________________________
consensus CCCAGCTTCTTATCTTCCCACTTCAATCGCTGTGTTTTGGCCTTTGGCCTTTGGCCTTCC