Previous Contig 004620:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018E07Sequence583004620 (6)gb:AY250116_1592725e-101Lycopersicon pennellii aconitase mRNA, partial cds.748010024 (6)gb:AF194945_17758054e-73Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMFS138G12Sequence505004620 (6)gb:AY250116_15927254e-85Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS139F01Sequence619004620 (6)sp|P49608|ACOC_CUCMAe-110Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).
JMSF004I08Sequence311004620 (6)sp|P49608|ACOC_CUCMA6e-51Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).376010024 (6)gb:AF194945_17758052e-06Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMSF028H15Sequence665004620 (6)gb:AY250116_1592725e-118Lycopersicon pennellii aconitase mRNA, partial cds.783010024 (6)gb:AF194945_17758053e-78Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMSF034F05Sequence699004620 (6)gb:AY250116_1592725e-124Lycopersicon pennellii aconitase mRNA, partial cds.736010024 (6)gb:AF194945_17758053e-71Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS139F01+ AGGAGGTGAAGCAAGGTAGTTAGCCCGTGTTAAGGGATGAAC
                      ____________________________________________________________
consensus AGGAGGTGAAGCAAGGTAGTTAGCCCGTGTTAAGGGATGAAC
 
. : . : . : . : . : . :
JMFS139F01+ ACGGCCCTCAAAATTACGGTTTCCAGAAAGTACAGCAGCTGCAACAATGTCATTGTCAGA
JMFF018E07+ TTACGGTTTCCAGAAAGTACAGCAGCTGCAACAATGTCATTGTCAGA
JMSF034F05+ TCCAGAAAGTACAGCAGCTGCAACAATGTCATTGTCAGA
JMSF028H15+ TCAGA
                      ____________________________________________________________
consensus ACGGCCCTCAAAATTACGGTTTCCAGAAAGTACAGCAGCTGCAACAATGTCATTGTCAGA
 
. : . : . : . : . : . :
JMFS139F01+ TATAGCAGAAGAAACTGACTCATCTAAGTCACCAGAATTGCCAATGCAGGTAGTGCAGCC
JMFS138G12+ ACCAGAATTGCCAATGCAGGTAGTGCAGCC
JMFF018E07+ TATAGCAGAAGAAACTGACTCATCTAAGTCACCAGAATTGCCAATGCAGGTAGTGCAGCC
JMSF034F05+ TATAGCAGAAGAAACTGACTCATCTAAGTCACCAGAATTGCCAATGCAGGTAGTGCAGCC
JMSF028H15+ TATAGCAGAAGAAACTGACTCATCTAAGTCACCAGAATTGCCAATGCAGGTAGTGCAGCC
                      ____________________________________________________________
consensus TATAGCAGAAGAAACTGACTCATCTAAGTCACCAGAATTGCCAATGCAGGTAGTGCAGCC
 
. : . : . : . : . : . :
JMFS139F01+ ATATCCAACAATATGGAAACCTTGCTGGTTCAGATACTCCTGCAGCCCACTTTGAAGTAA
JMFS138G12+ ATATCCAACAATATGGAAACCTTGCTGGTTCAGATACTCCTGCAGCCCACTTTGAAGTAA
JMFF018E07+ ATATCCAACAATATGGAAACCTTGCTGGTTCAGATACTCCTGCAGCCCACTTTGAAGTAA
JMSF034F05+ ATATCCAACAATATGGAAACCTTGCTGGTTCAGATACTCCTGCAGCCCACTTTGAAGTAA
JMSF028H15+ ATATCCAACAATATGGAAACCTTGCTGGTTCAGATACTCCTGCAGCCCACTTTGAAGTAA
                      ____________________________________________________________
consensus ATATCCAACAATATGGAAACCTTGCTGGTTCAGATACTCCTGCAGCCCACTTTGAAGTAA
 
. : . : . : . : . : . :
JMFS139F01+ ATATTTTGTAACAACTCCAGATCCTGGGGCAAGGCTTGTTTTAACCCATGGTTTAACATG
JMFS138G12+ ATATTTTGTAACAACTCCAGATCCTGGGGCAAGGCTTGTTTTAACCCATGGTTTAACATG
JMFF018E07+ ATATTTTGTAACAACTCCAGATCCTGGGGCAAGGCTTGTTTTAACCCATGGTTTAACATG
JMSF034F05+ ATATTTTGTAACAACTCCAGATCCTGGGGCAAGGCTTGTTTTAACCCATGGTTTAACATG
JMSF028H15+ ATATTTTGTAACAACTCCAGATCCTGGGGCAAGGCTTGTTTTAACCCATGGTTTAACATG
                      ____________________________________________________________
consensus ATATTTTGTAACAACTCCAGATCCTGGGGCAAGGCTTGTTTTAACCCATGGTTTAACATG
 
. : . : . : . : . : . :
JMFS139F01+ TAGACCCAACTCAGAGGCCTTTTTAGCCACAAGTGCTGCTCCCAGCATAACACTAGGATT
JMFS138G12+ TAGACCCAACTCAGAGGCCTTTTTAGCCACAAGTGCTGCTCCCAGCATAACACTAGGATT
JMFF018E07+ TAGACCCAACTCAGAGGCCTTTTTAGCCACAAGTGCTGCTCCCAGCATAACACTAGGATT
JMSF034F05+ TAGACCCAACTCAGAGGCCTTTTTAGCCACAAGTGCTGCTCCCAGCATAACACTAGGATT
JMSF028H15+ TAGACCCAACTCAGAGGCCTTTTTAGCCACAAGTGCTGCTCCCAGCATAACACTAGGATT
                      ____________________________________________________________
consensus TAGACCCAACTCAGAGGCCTTTTTAGCCACAAGTGCTGCTCCCAGCATAACACTAGGATT
 
. : . : . : . : . : . :
JMFS139F01+ TGATGTATTTGTGCAACTTGTGATGGCAGCAATTACAACACTACCATGTTTGAGTTCTGC
JMFS138G12+ TGATGTATTTGTGCAACTTGTGATGGCAGCAATTACAACACTACCATGTTTGAGTTCTGC
JMFF018E07+ TGATGTATTTGTGCAACTTGTGATGGCAGCAATTACAACACTACCATGTTTGAGTTCTGC
JMSF034F05+ TGATGTATTTGTGCAACTTGTGATGGCAGCAATTACAACACTACCATGTTTGAGTTCTGC
JMSF028H15+ TGATGTATTTGTGCAACTTGTGATGGCAGCAATTACAACACTACCATGTTTGAGTTCTGC
                      ____________________________________________________________
consensus TGATGTATTTGTGCAACTTGTGATGGCAGCAATTACAACACTACCATGTTTGAGTTCTGC
 
. : . : . : . : . : . :
JMFS139F01+ AGGCTGTCCATGGAAAGAAAACTTTGCCACTTTTTCTTGTGCCTCCTTAGGCACGGCAAA
JMFS138G12+ AGGCTGTCCATGGAAAGAAAACTTTGCCACTTTTTCTTGTGCCTCCTTAGGCACGGCAAA
JMFF018E07+ AGGCTGTCCATGGAAAGAAAACTTTGCCACTTTTTCTTGTGCCTCCTTAGGCACGGCAAA
JMSF034F05+ AGGCTGTCCATGGAAAGAAAACTTTGCCACTTTTTCTTGTGCCTCCTTAGGCACGGCAAA
JMSF028H15+ AGGCTGTCCATGGAAAGAAAACTTTGCCACTTTTTCTTGTGCCTCCTTAGGCACGGCAAA
JMSF004I08+ GGCACGGCAAA
                      ____________________________________________________________
consensus AGGCTGTCCATGGAAAGAAAACTTTGCCACTTTTTCTTGTGCCTCCTTAGGCACGGCAAA
 
. : . : . : . : . : . :
JMFS139F01+ ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
JMFS138G12+ ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
JMFF018E07+ ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
JMSF034F05+ ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
JMSF028H15+ ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
JMSF004I08+ ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
                      ____________________________________________________________
consensus ACCCTTGAATCCCACTTTGTTATCAAGGCAGGAATGCCAGTCAGACTTCATCTCTTTGAG
 
. : . : . : . : . : . :
JMFS139F01+ AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
JMFS138G12+ AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
JMFF018E07+ AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
JMSF034F05+ AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
JMSF028H15+ AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
JMSF004I08+ AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
                      ____________________________________________________________
consensus AGGTACACGATCATGTGGTCTTTTTGGCCCTGACAAACATGGTTCAACATCCACAAGGTC
 
. : . : . : . : . : . :
JMFS139F01+ CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTTGA
JMFS138G12+ CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTT
JMFF018E07+ CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTTGAGGCTCATTATAGTCAACAA
JMSF034F05+ CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTTGAGGCTCATTATAGTCAACAAACAT
JMSF028H15+ CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTTGAGGCTCATTATAGTCAACAAACAT
JMSF004I08+ CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTTGAGGCTCATTATAGCCAACAAACAT
                      ____________________________________________________________
consensus CAGTTGCAAGGAAGATGAATACACTCTTTCTTGTTGAGGCTCATTATAGTCAACAAACAT
 
. : . : . : . : . : . :
JMSF034F05+ GTTATTTGCACGAAGATAAGCCTCAATCATCGCCACAGTCTCATCACTTCTCCCAGTCAA
JMSF028H15+ GTTATTTGCACGAAGATAAGCCTCAATCATCGCCACAGTCTCATCACTTCTCCCAGTCAA
JMSF004I08+ GTTATTTGCACGAAGATAAGCCTCAATCATCGCCACAGTCTCATCACTTCTCCCAGTCAA
                      ____________________________________________________________
consensus GTTATTTGCACGAAGATAAGCCTCAATCATCGCCACAGTCTCATCACTTCTCCCAGTCAA
 
. : . : . : . : . : . :
JMSF034F05+ TTTAAGATATTGCAAAGTAACATGATCTACAGGGAAGAATCCCATAGTTGCACCATATTC
JMSF028H15+ TTTAAGATATTGCAAAGTAACATGATCTACAGGGAAGAATCCCATAGTTGCACCATATTC
JMSF004I08+ TTTAAGATATTGCAAAGTAACATGATCTACAGGGAAGAATCCCATAGTTGCACCATATTC
                      ____________________________________________________________
consensus TTTAAGATATTGCAAAGTAACATGATCTACAGGGAAGAATCCCATAGTTGCACCATATTC