Previous Contig 004617:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS074B02Sequence621004617 (7)gb:BT002474_16360771e-34Arabidopsis thaliana unknown protein (At5g16520) mRNA, complete cds.>gb:BT008370
JMFS102C03Sequence626004617 (7)gb:BT002474_16360773e-39Arabidopsis thaliana unknown protein (At5g16520) mRNA, complete cds.>gb:BT008370
JMFS109A03Sequence627004617 (7)gb:BT002474_16360777e-39Arabidopsis thaliana unknown protein (At5g16520) mRNA, complete cds.>gb:BT008370
JMFS110H02Sequence622004617 (7)gb:BT002474_16360779e-50Arabidopsis thaliana unknown protein (At5g16520) mRNA, complete cds.>gb:BT008370
JMFS133B10Sequence601004617 (7)gb:BT002474_16360772e-33Arabidopsis thaliana unknown protein (At5g16520) mRNA, complete cds.>gb:BT008370
JMFS162H03Sequence564004617 (7)gb:BT002474_16360774e-30Arabidopsis thaliana unknown protein (At5g16520) mRNA, complete cds.>gb:BT008370
JMSF004H21Sequence337004617 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS110H02+ CCTCGATGGTTCTCTTGGATATG
                      ____________________________________________________________
consensus CCTCGATGGTTCTCTTGGATATG
 
. : . : . : . : . : . :
JMFS110H02+ AGTTGGTAAAGCAACGCAACAAATAGACCAATANAAAGTATCAAACTTGCTATCGAGCAA
JMFS102C03+ TCGAGCAA
JMFS109A03+ TCGAGCAA
                      ____________________________________________________________
consensus AGTTGGTAAAGCAACGCAACAAATAGACCAATANAAAGTATCAAACTTGCTATCGAGCAA
 
. : . : . : . : . : . :
JMFS110H02+ GTTCCGCCCAGCTCTGTTTTGCGCTTCTTAACTACCTTCTGGTCATCAAGAAAATGGCGA
JMFS102C03+ GTTCCGCCCAGCTCTGTTNTGCGCTTCTTAACTACCTTCTGGTCATCAAGAAAATGGCGA
JMFS109A03+ GTTCCGCCCAGCTCTGTTNTGCGCTTCTTAACTACCTTCTGGTCATCAAGAAAATGGCGA
JMFS133B10+ TTAACTACCTTCTGGTCATCAAGAAAATGGCGA
JMFS162H03+ AAAATGGCGA
JMFS074B02+ GCTTCTTAACTACCTTCTGGTCATCAAGAAAATGGCGA
                      ____________________________________________________________
consensus GTTCCGCCCAGCTCTGTTTTGCGCTTCTTAACTACCTTCTGGTCATCAAGAAAATGGCGA
 
. : . : . : . : . : . :
JMFS110H02+ GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
JMFS102C03+ GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
JMFS109A03+ GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
JMFS133B10+ GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
JMFS162H03+ GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
JMFS074B02+ GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
                      ____________________________________________________________
consensus GTGGCGAAGCAGATGTCGAGGCGGCTAATCCACCACCGGATCTGGAACCATAAGGAGCGT
 
. : . : . : . : . : . :
JMFS110H02+ CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
JMFS102C03+ CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
JMFS109A03+ CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
JMFS133B10+ CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
JMFS162H03+ CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
JMFS074B02+ CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
                      ____________________________________________________________
consensus CCATCGCCTAGCGGAGCGAAACGAGCTAAGAAGCATACGACGAGCCAGGAGAGGACTAAA
 
. : . : . : . : . : . :
JMFS110H02+ ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
JMFS102C03+ ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
JMFS109A03+ ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
JMFS133B10+ ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
JMFS162H03+ ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
JMFS074B02+ ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
                      ____________________________________________________________
consensus ACGAAGGTTGCCTGAAGGATCACAGACTGCGAATGGGTGAGCTTCTTCATGGAATCAAAG
 
. : . : . : . : . : . :
JMFS110H02+ TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
JMFS102C03+ TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
JMFS109A03+ TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
JMFS133B10+ TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
JMFS162H03+ TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
JMFS074B02+ TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
                      ____________________________________________________________
consensus TCGAAGATAGTGCTACTGCCAGGGAGGGAAACGGAGTTGTAGTCCACGCCGGATTCCACC
 
. : . : . : . : . : . :
JMFS110H02+ TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
JMFS102C03+ TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
JMFS109A03+ TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
JMFS133B10+ TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
JMFS162H03+ TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
JMFS074B02+ TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
JMSF004H21+ GAGCGAGCAGNTCCGGCGAGCAGCGTCGAACACGTAA
                      ____________________________________________________________
consensus TCAATTGGACCCCAGTCGGCGAAGAGCGAGCAGCTCCGGCGAGCAGCGTCGAACACGTAA
 
. : . : . : . : . : . :
JMFS110H02+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
JMFS102C03+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
JMFS109A03+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
JMFS133B10+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
JMFS162H03+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
JMFS074B02+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
JMSF004H21+ CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
                      ____________________________________________________________
consensus CCAGGGTTGCAGGCGCACAAGGTTCCATTGTACCGAAAAGAGTTGCTCGGACACTGCATT
 
. : . : . : . : . : . :
JMFS110H02+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
JMFS102C03+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
JMFS109A03+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
JMFS133B10+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
JMFS162H03+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
JMFS074B02+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
JMSF004H21+ TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
                      ____________________________________________________________
consensus TTCTCCTCCTTGGACTACTTCGCCTCCTCGGCGCGGCTGCCGGACAATGATATCGGCGGC
 
. : . : . : . : . : . :
JMFS110H02+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAA
JMFS102C03+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
JMFS109A03+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
JMFS133B10+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
JMFS162H03+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
JMFS074B02+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
JMSF004H21+ ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
                      ____________________________________________________________
consensus ACGGCAGATTAGTGGCGAAGTAAAGAACACATGGAGAGAAAAGCTTAGAAGCAAAGAAAG
 
. : . : . : . : . : . :
JMFS102C03+ AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
JMFS109A03+ AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
JMFS133B10+ AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
JMFS162H03+ AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
JMFS074B02+ AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
JMSF004H21+ AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
                      ____________________________________________________________
consensus AAAACGTGAAAGGATCGATTTAGAGCTTCTTTTCTTTGTTTCTTTTACCAGAATCGGAAT
 
. : . : . : . : . : . :
JMFS102C03+ TTAGATAAGCTAAA
JMFS109A03+ TTAGATAAGCTAAACATGT
JMFS133B10+ TTAGATAAGCTAAACATGTACAGCCTGA
JMFS162H03+ TTAGATAAGCTAAA
JMFS074B02+ TTAGATAAGCTAAACATGTACAGCCTGACAATGGCGGTTTCTT
JMSF004H21+ TTAGATAAGCTAAACATGTACAGCCTGACAATGGCGGTTTCTTGCCACGGTGGTAAGATC
                      ____________________________________________________________
consensus TTAGATAAGCTAAACATGTACAGCCTGACAATGGCGGTTTCTTGCCACGGTGGTAAGATC