Previous Contig 004615:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004H17Sequence401004615 (4)gb:ATAC016827_15436212e-18Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence, complete sequenc
JMSF031K02Sequence707004615 (4)gb:ATAC016827_15436215e-38Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence, complete sequenc739004615 (4)gb:ATAC016827_15436211e-38Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence, complete sequenc
JMSF039M09Sequence699004615 (4)gb:ATAC016827_15436211e-44Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence, complete sequenc901023867gb:ATAC016827_15436212e-50Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031K02- ATACAATGGATAATC
                      ____________________________________________________________
consensus ATACAATGGATAATC
 
. : . : . : . : . : . :
rJMSF031K02- ACAGAACAAAAATAGTGAAAACTGACAAAGTGATAGATATAGAGGATTAGAAATAAGGAG
                      ____________________________________________________________
consensus ACAGAACAAAAATAGTGAAAACTGACAAAGTGATAGATATAGAGGATTAGAAATAAGGAG
 
. : . : . : . : . : . :
rJMSF031K02- AATATCTAAATTAGCAAAACACGATAGTTATAAAGAGCATACAAGCTTGCCTTGTGGTGA
JMSF039M09+ CTTGTGGTGA
JMSF031K02+ CTTGTGGTGA
                      ____________________________________________________________
consensus AATATCTAAATTAGCAAAACACGATAGTTATAAAGAGCATACAAGCTTGCCTTGTGGTGA
 
. : . : . : . : . : . :
rJMSF031K02- AGAACTGCTTTCTTCCGAGCAGTCTTAACATCACCATGCGCTTCTAAGCTAACAAGTAAA
JMSF039M09+ AGAACTGCTTTCTTCCGAGCAGTCTTAACATCACCATGCGCTTCTAAGCTAACAAGTAAA
JMSF031K02+ AGAACTGCTTTCTTCCGAGCAGTCTTAACATCACCATGCGCTTCTAAGCTAACAAGTAAA
                      ____________________________________________________________
consensus AGAACTGCTTTCTTCCGAGCAGTCTTAACATCACCATGCGCTTCTAAGCTAACAAGTAAA
 
. : . : . : . : . : . :
rJMSF031K02- ATATCCTCTGGTGTTAGCAAAAGCTCTGAACAAAGATTAAGGGCATAAAGGGATTTGTCA
JMSF039M09+ ATATCCTCTGGTGTTAGCAAAAGCTCTGAACAAAGATTAAGGGCATAAAGGGATTTGTCA
JMSF031K02+ ATATCCTCTGGTGTTAGCAAAAGCTCTGAACAAAGATTAAGGGCATAAAGGGATTTGTCA
                      ____________________________________________________________
consensus ATATCCTCTGGTGTTAGCAAAAGCTCTGAACAAAGATTAAGGGCATAAAGGGATTTGTCA
 
. : . : . : . : . : . :
rJMSF031K02- GAAAGGTGTCTCCTAACAGTTTGATGCCACGAGGATTCTGATGGGTGTACAGATTCTTTG
JMSF039M09+ GAAAGGTGTCTCCTAACAGTTTGATGCCACGAGGATTCTGATGGGTGTACAGATTCTTTG
JMSF031K02+ GAAAGGTGTCTCCTAACAGTTTGATGCCACGAGGATTCTGATGGGTGTACAGATTCTTTG
                      ____________________________________________________________
consensus GAAAGGTGTCTCCTAACAGTTTGATGCCACGAGGATTCTGATGGGTGTACAGATTCTTTG
 
. : . : . : . : . : . :
rJMSF031K02- TTTCTAATAGAAGAGATAAGTTTCTGCACATTTAGCTGACCAAGCAGTGTTGTAAACCAA
JMSF039M09+ TTTCTAATAGAAGAGATAAGTTTCTGCACATTTAGCTGACCAAGCAGTGTTGTAAACCAA
JMSF031K02+ TTTCTAATAGAAGAGATAAGTTTCTGCACATTTAGCTGACCAAGCAGTGTTGTAAACCAA
                      ____________________________________________________________
consensus TTTCTAATAGAAGAGATAAGTTTCTGCACATTTAGCTGACCAAGCAGTGTTGTAAACCAA
 
. : . : . : . : . : . :
rJMSF031K02- TTTTCACGGAGGTTAAGAGAAAGCGCCCGCTGAAGCAAGAAGCCGCGGCCGGCGACCAAT
JMSF039M09+ TTTTCACGGAGGTTAAGAGAAAGCGCCCGCTGAAGCAAGAAGCCGCGGCCGGCGACCAAT
JMSF031K02+ TTTTCACGGAGGTTAAGAGAAAGCGCCCGCTGAAGCAAGAAGCCGCGGCCGGCGACCAAT
JMSF004H17+ AAAGCGCCCGCTGAAGCANGAAGCCGCGNCCGGCGACCAAT
                      ____________________________________________________________
consensus TTTTCACGGAGGTTAAGAGAAAGCGCCCGCTGAAGCAAGAAGCCGCGGCCGGCGACCAAT
 
. : . : . : . : . : . :
rJMSF031K02- GAAGGGACAAAGGGAGCGGCCATGAAGCGCTGAAAGAAATCGACTTGTCCGGGCATGGAA
JMSF039M09+ GAAGGGACAAAGGGAGCGGCCATGAAGCGCTGAAAGAAATCGACTTGTCCGGGCATGGAA
JMSF031K02+ GAAGGGACAAAGGGAGCGGCCATGAAGCGCTGAAAGAAATCGACTTGTCCGGGCATGGAA
JMSF004H17+ GAAGGGACAAAGGGAGCGGCCATGAAGCGCTGAAAGAAATCGACTTGTCCGGGCATGGAA
                      ____________________________________________________________
consensus GAAGGGACAAAGGGAGCGGCCATGAAGCGCTGAAAGAAATCGACTTGTCCGGGCATGGAA
 
. : . : . : . : . : . :
rJMSF031K02- AGCCGAGGACTCCGAGAAGCTCCCAAGGGAAGCGGGTCTCCGGGAACCGGCCGTGCCTGA
JMSF039M09+ AGCCGAGGACTCCGAGAAGCTCCCAAGGGAAGCGGGTCTCCGGGAACCGGCCGTGCCTGA
JMSF031K02+ AGCCGAGGACTCCGAGAAGCTCCCAAGGGAAGCGGGTCTCCGGGAACCGGCCGTGCCTGA
JMSF004H17+ AGCCGAGGACTCCGAGAAGCTCCCAAGGGAAGCGGGTCTCCGGGAACCGGCCGTGCCTGA
                      ____________________________________________________________
consensus AGCCGAGGACTCCGAGAAGCTCCCAAGGGAAGCGGGTCTCCGGGAACCGGCCGTGCCTGA
 
. : . : . : . : . : . :
rJMSF031K02- CCGTCGAGGGTCACCGGCGTCGATAAATCCAAGTCCCAAAACCCTGCAGCGTCCATTGCC
JMSF039M09+ CCGTCGAGGGTCACCGGCGTCGATAAATCCAAGTCCCAAAACCCTGCAGCGTCCATTGCC
JMSF031K02+ CCGTCGAGGGTCACCGGCGTCGATAAATCCAAGTCCCAAAACCCTGCAGCGTCCATTGCC
JMSF004H17+ CCGTCGAGGGTCACCGGNGTCGATAAATCCAAGTCCCAAAACCCTGCAGCGTCCATTGCC
                      ____________________________________________________________
consensus CCGTCGAGGGTCACCGGCGTCGATAAATCCAAGTCCCAAAACCCTGCAGCGTCCATTGCC
 
. : . : . : . : . : . :
rJMSF031K02- CATCTCAGCTTCCTCATCTTTTTCCTCTTCGGCAGATACCCAGAATACTAATCTCTCTGG
JMSF039M09+ CATCTCAGCTTCCTCATCTTTTTCCTCTTCGGCAGATACCCAGAATACTAATCTCTCTGG
JMSF031K02+ CATCTCAGCTTCCTCATCTTTTTCCTCTTCGGCAGATACCCAGAATACTAATCTCTCTGG
JMSF004H17+ CATCTCAGCTTCCTCATCTTTTTCCTCTTCGGCAGATACCCAGAATANTAATCTCTCTGG
                      ____________________________________________________________
consensus CATCTCAGCTTCCTCATCTTTTTCCTCTTCGGCAGATACCCAGAATACTAATCTCTCTGG
 
. : . : . : . : . : . :
rJMSF031K02- AAGTGACAGAG-ANTAATTCGAATTTAGGAG--GCATTTCATTCTNCCAAA
JMSF039M09+ AAGTGACAGAGAATTAATTCGAATTTAGGAGCTGCATTTCATTCTTCCAAAATTGTGAGA
JMSF031K02+ AAGTGACAGAGAATTAATTCGAATTTAGGAG--GCATTTCATTCTTCCAAAATTGTGAGA
JMSF004H17+ AAGTGACAGAGAATTAATTCGAATTTAGGAGCTGCATTTCATTCTTCCAAAATTGTGAGA
                      ____________________________________________________________
consensus AAGTGACAGAGAATTAATTCGAATTTAGGAG--GCATTTCATTCTTCCAAAATTGTGAGA
 
. : . : . : . : . : . :
JMSF039M09+ AATTTCATGCCTCAGCGGACAGGACGAAGTTGGACTTC
JMSF031K02+ AATTTCATGCCTCAGCGGACAGGACGAAGTTGGACTTCAAATGAAATGGCCAAAGC
JMSF004H17+ AATTTCATGCCTCAGCGGACAGGACGAAGTTGGACTTCAAATGAAATGGCCAAAGCAACC
                      ____________________________________________________________
consensus AATTTCATGCCTCAGCGGACAGGACGAAGTTGGACTTCAAATGAAATGGCCAAAGCAACC