Previous Contig 004612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021O23Sequence412004612 (5)gb:AB035183_15189262e-31Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd490009640 (6)gb:AB035183_15189261e-63Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF030J12Sequence417004612 (5)gb:AB035183_15189265e-32Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd674009640 (6)gb:AB035183_15189264e-91Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF004H04Sequence331004612 (5)gb:AB035183_15189262e-16Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF017C14Sequence403004612 (5)gb:AB035183_15189267e-29Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd712009640 (6)gb:AB035183_1518926e-103Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF036N05Sequence615004612 (5)gb:AB035183_15189265e-49Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd722009640 (6)gb:AB035183_1518926e-102Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036N05+ ANGNGNGNCNNGGAA
                      ____________________________________________________________
consensus ANGNGNGNCNNGGAA
 
. : . : . : . : . : . :
JMSF036N05+ ANGGGCAAGNGGGAAGGAAGAAANGTNNCCNGANGTNTCANCAGAGGGGAGGAGNTTCNT
                      ____________________________________________________________
consensus ANGGGCAAGNGGGAAGGAAGAAANGTNNCCNGANGTNTCANCAGAGGGGAGGAGNTTCNT
 
. : . : . : . : . : . :
JMSF036N05+ GAGNTNCAANNTNGGAGTAAAGTCCCCAAAATCNTCAANNGNNGNGTCACTNTNGGCNTC
                      ____________________________________________________________
consensus GAGNTNCAANNTNGGAGTAAAGTCCCCAAAATCNTCAANNGNNGNGTCACTNTNGGCNTC
 
. : . : . : . : . : . :
JMSF036N05+ CACAAACAAAGCCCCTTCTCCATTACACTCAATCTCAAGCCTCCCCATCTCCATCCCTAC
                      ____________________________________________________________
consensus CACAAACAAAGCCCCTTCTCCATTACACTCAATCTCAAGCCTCCCCATCTCCATCCCTAC
 
. : . : . : . : . : . :
JMFF030J12+ ACCCGCCATTGGATAGAACGAAACCAGAACTCTGCTCAGGGCTTCCTTCATCG
JMFF021O23+ ACCCGCCATTGGATAGAACGAAACCAGAACTCTGCTCAGGGCTTCCTTCATCG
JMSF036N05+ CCATCCTACCCGCCATTGGATAGAACGAAACCAGAACTCTGCTCAGGGCTTCCTTCATCG
JMSF017C14+ GGATAGAACGAAACCAGAACTCTGCTCAGGGCTTCCTTCATCG
                      ____________________________________________________________
consensus CCATCCTACCCGCCATTGGATAGAACGAAACCAGAACTCTGCTCAGGGCTTCCTTCATCG
 
. : . : . : . : . : . :
JMFF030J12+ CCTTGGGATCAAAGAAGTTTGGAGACCCATTGGGCCTGTAAAAGTAAACCACCAACAAAT
JMFF021O23+ CCTTGGGATCAAAGAAGTTTGGAGACCCATTGGGCCTGTAAAAGTAAACCACCAACAAAT
JMSF036N05+ CCTTGGGATCAAAGAAGTTTGGAGACCCATTGGGCCTGTAAAAGTAAACCACCAACAAAT
JMSF017C14+ CCTTGGGATCAAAGAAGTTTGGAGACCCATTGGGCCTGTAAAAGTAAACCACCAACAAAT
JMSF004H04+ TTGGGCCTGTAAAAGTAAACCACCAACAAAT
                      ____________________________________________________________
consensus CCTTGGGATCAAAGAAGTTTGGAGACCCATTGGGCCTGTAAAAGTAAACCACCAACAAAT
 
. : . : . : . : . : . :
JMFF030J12+ GGATCCTCCCCACTACCAAATCCACATTTGAGCACCACAACTTCTTGCTTGGTGTAGGCT
JMFF021O23+ GGATCCTCCCCACTACCAAATCCACATTTGAGCACCACAACTTCTTGCTTGGTGTAGGCT
JMSF036N05+ GGATCCTCCCCACTACCAAATCCACATTTGAGCACCACAACTTCTTGCTTGGTGTAGGCT
JMSF017C14+ GGATCCTCCCCACTACCAAATCCACATTTGAGCACCACAACTTCTTGCTTGGTGTAGGCT
JMSF004H04+ GGATCCTCCCCACTACCAAATCCACATTTGAGCACCACAACTTCTTGCTTGGTGTAGGCT
                      ____________________________________________________________
consensus GGATCCTCCCCACTACCAAATCCACATTTGAGCACCACAACTTCTTGCTTGGTGTAGGCT
 
. : . : . : . : . : . :
JMFF030J12+ TGGCTGGTTTCACCATTGTGGTTTCCTTTATGCATATCCTCAGCTTCTCACTTGCCATAT
JMFF021O23+ TGGCTGGTTTCACCATTGTGGTTTCCTTTATGCATATCCTCAGCTTCTCACTTGCCATAT
JMSF036N05+ TGGCTGGTTTCACCATTGTGGTTTCCTTTATGCATATCCTCAGCTTCTCACTTGCCATAT
JMSF017C14+ TGGCTGGTTTCACCATTGTGGTTTCCTTTATGCATATCCTCAGCTTCTCACTTGCCATAT
JMSF004H04+ TGGCTGGTTTCACCATTGTGGTTTCCTTTATGCATATCCTCAGCTTCTCACTTGCCATAT
                      ____________________________________________________________
consensus TGGCTGGTTTCACCATTGTGGTTTCCTTTATGCATATCCTCAGCTTCTCACTTGCCATAT
 
. : . : . : . : . : . :
JMFF030J12+ TTGTGTTAAAACAGTAATCTTTTTTGTGGAAATTAAGCCAAAGAAAATATGGGAATTCTT
JMFF021O23+ TTGTGTTAAAACAGTAATCTTTTTTGTGGAAATTAAGCCAAAGAAAATATGGGAATTCTT
JMSF036N05+ TTGTGTTAAAACAGTAATCTTTTTTGTGGAAATTAAGCCAAAGAAAATATGGGAATTCTT
JMSF017C14+ TTGTGTTAAAACAGTAATCTTTTTTGTGGAAATTAAGCCAAAGAAAATATGGGAATTCTT
JMSF004H04+ TTGTGTTAAAACAGTAATCTTTTTTGTGGAAATTAAGCCAAAGAAAATATGGGAATTCTT
                      ____________________________________________________________
consensus TTGTGTTAAAACAGTAATCTTTTTTGTGGAAATTAAGCCAAAGAAAATATGGGAATTCTT
 
. : . : . : . : . : . :
JMFF030J12+ GCAAGCTCTACAAAAACTAGGTGGGAATGAAAGAAATCAAAGAAGGGAAGAGAGGAGGTT
JMFF021O23+ GCAAGCTCTACAAAANCTAGGTGGGAATGAAAGAAATCAAAGAAGGGAAGAGAGGAGGTT
JMSF036N05+ GCAAGCTCTACAAAAACTAGGTGGGAATGAAAGAAATCAAAGAAGGGAAGAGAGGAGGTT
JMSF017C14+ GCAAGCTCTACAAAAACTAGGTGGGAATGAAAGAAATCAAAGAAGGGAAGAGAGGAGGTT
JMSF004H04+ GCAAGCTCTACAAAAACTAGGTGGGAATGAAAGAAATCAAAGAAGGGAAGAGAGGAGGTT
                      ____________________________________________________________
consensus GCAAGCTCTACAAAAACTAGGTGGGAATGAAAGAAATCAAAGAAGGGAAGAGAGGAGGTT
 
. : . : . : . : . : . :
JMFF030J12+ TCCGCGACCTCTCAATTTGATTTCATTACAAGGGGATAAAGCTGTGAATGAATACATGT
JMFF021O23+ TCCGCGACCTCTCAATTTGATTTCATTACAAGGGGATAAAGCTGTGAATGAATACATGT
JMSF036N05+ TCCGCGACCTCTCAATTTGATTTCATTACAAGGGGATAAAGCTGTGAATGAATACATGT
JMSF017C14+ TCCGCGACCTCTCAATTTGATTTCATTACAAGGGGATAAAGCTGTGAATGAATACATGT
JMSF004H04+ TCCGCGACCTCTCAATTTGATTTCATTACAAGGGGATAAAGCTGTGAATGAATACATGTC
                      ____________________________________________________________
consensus TCCGCGACCTCTCAATTTGATTTCATTACAAGGGGATAAAGCTGTGAATGAATACATGTC