Previous Contig 004611:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004H01Sequence379004611 (2)gb:AB013389_15120642e-08Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13.
JMSF006E19Sequence476004793 (2)pir|T51500|T515000.016hypothetical protein F5E19_20 - Arabidopsis thaliana>gb:ATF5E19_1550757 Arabidop511004611 (2)gb:AC004482_15317635e-35Arabidopsis thaliana chromosome 2 clone F27L4 map CIC06C07, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF006E19+ GGGGGATGAACGACAAGCATATGTGATTGAACGCCCGGA
                      ____________________________________________________________
consensus GGGGGATGAACGACAAGCATATGTGATTGAACGCCCGGA
 
. : . : . : . : . : . :
rJMSF006E19+ GNCACTCGTGCATTTTGCACTGTGTTCTGGCAACCATTCAGATCCCGCGGTCAGAGTATA
                      ____________________________________________________________
consensus GNCACTCGTGCATTTTGCACTGTGTTCTGGCAACCATTCAGATCCCGCGGTCAGAGTATA
 
. : . : . : . : . : . :
rJMSF006E19+ CACGCCAAAACGAATACTTCAAGAACTGGAAGCAGCAAAAGAAGAGTATATAAGAGCCAC
                      ____________________________________________________________
consensus CACGCCAAAACGAATACTTCAAGAACTGGAAGCAGCAAAAGAAGAGTATATAAGAGCCAC
 
. : . : . : . : . : . :
rJMSF006E19+ CTTTGGTGNGAGGAAGGATCACAAGATCCTTCTACCCAAGATTGTCGAGTCATTCGCCAA
JMSF004H01+ ATTGTCGAGTCATTCGCCAA
                      ____________________________________________________________
consensus CTTTGGTGNGAGGAAGGATCACAAGATCCTTCTACCCAAGATTGTCGAGTCATTCGCCAA
 
. : . : . : . : . : . :
rJMSF006E19+ GCANTCAGGCCTGTGCCCCGTGGCTGTAATGGAAATGCTCCAGCAGTCTTTGCCCGATTC
JMSF004H01+ GCACTCAGGCCTGTGCCCCGTGGCTGTAATGGAAATGCTCCAGCAGTCTTTGCCCGATTC
                      ____________________________________________________________
consensus GCACTCAGGCCTGTGCCCCGTGGCTGTAATGGAAATGCTCCAGCAGTCTTTGCCCGATTC
 
. : . : . : . : . : . :
rJMSF006E19+ CCTGAAGAAGAGCCTCAAGAAATGCCAGCAAGGAAAGGCACGCAAGAGCATCGAATGGGT
JMSF004H01+ CCTGAAGAAGAGCCTCAAGAAATGCCAGCAAGGAAAGGCACGCAAGAGCATCGAATGGGT
                      ____________________________________________________________
consensus CCTGAAGAAGAGCCTCAAGAAATGCCAGCAAGGAAAGGCACGCAAGAGCATCGAATGGGT
 
. : . : . : . : . : . :
rJMSF006E19+ TCCCCACAGTTCCAGTTTCCGATATCTCATACNGAAGGANCTGGTGGAGTAATATAATTG
JMSF004H01+ TCCCCACAGTTCCAGTTTCCGATATCTCATACTGAAGGAACTGGTGGAGTAATATAATTG
                      ____________________________________________________________
consensus TCCCCACAGTTCCAGTTTCCGATATCTCATACTGAAGGAACTGGTGGAGTAATATAATTG
 
. : . : . : . : . : . :
rJMSF006E19+ GTCGCTTGCTTGCTTGCTTACGGGTAGTTAATCCGAACTGGGAGGATAGATTTTCCATAG
JMSF004H01+ GTCGCTTGCTTGCTTGCTTACGGGTAGTTAATCCGAACTGGGAGGATAGATTTTCCATAG
                      ____________________________________________________________
consensus GTCGCTTGCTTGCTTGCTTACGGGTAGTTAATCCGAACTGGGAGGATAGATTTTCCATAG
 
. : . : . : . : . : . :
rJMSF006E19+ GATAGATTCTCCATTGATGGAACTGAAGTTATTTGTAAGATTNGTGAAAGTT
JMSF004H01+ GATAGATTCTCCATTGATGGAA-TGAAGTTATTTGTAAGATTTGTGAAAGTTTCCTGCAT
                      ____________________________________________________________
consensus GATAGATTCTCCATTGATGGAACTGAAGTTATTTGTAAGATTTGTGAAAGTTTCCTGCAT
 
. : . : . : . : . : . :
JMSF004H01+ TGTTTGCGATGCTGCAAATTGGTTCTTTGTAGAGCTCTACTGTAAAAACAGTAAAGCTCC
                      ____________________________________________________________
consensus TGTTTGCGATGCTGCAAATTGGTTCTTTGTAGAGCTCTACTGTAAAAACAGTAAAGCTCC