Previous Contig 004610:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045N18Sequence627004610 (5)gb:BT002231_16358343e-15Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666597010587 (4)gb:BT002231_16358342e-73Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666
JMFS104C01Sequence570004610 (5)gb:AY070028_15666714e-12Arabidopsis thaliana unknown protein (At1g55680) mRNA, complete cds.>gb:AF360130
JMSF004G20Sequence355004610 (5)
JMSF029F20Sequence633004610 (5)gb:BT002231_16358341e-23Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666739010587 (4)gb:BT002231_1635834e-101Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666
JMSF036M03Sequence661004610 (5)gb:BT002231_16358341e-19Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666660010587 (4)gb:BT002231_16358342e-93Arabidopsis thaliana At1g78070/F28K19_28 mRNA, complete cds.>gb:AF372951_1792666

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029F20+ GACAAGCCTTGTGTTGAACTGG
                      ____________________________________________________________
consensus GACAAGCCTTGTGTTGAACTGG
 
. : . : . : . : . : . :
JMSF029F20+ AAGTCAAAGAAGCTGTGCCCTTTCACCACTTCCTTGTAGTCCTTTTTAAGCTCCTCTCGA
JMFF045N18+ AGTCAAAGAAGCTGTGCCCTTTCACCACTTCC-TGTAGTCC-TTTTAAGCTCCTCTCGA
JMSF036M03+ AGTCAAAGAAGCTGTGCCCTTTCACCACTTCCTTGTAGTCCTTTTTAAGCTCCTCTCGA
                      ____________________________________________________________
consensus AAGTCAAAGAAGCTGTGCCCTTTCACCACTTCCTTGTAGTCCTTTTTAAGCTCCTCTCGA
 
. : . : . : . : . : . :
JMSF029F20+ GAGCGCGAGAGGCTTTCATAGTTTTTGTATTGTTTCAACCTCGTTTCACGGTAATTCTCT
JMFF045N18+ GAGCGCGAGAGGCTTTCATAGTTTTTGTATTGTTTCAACCTCGTTTCACGGTAATTCTCT
JMFS104C01+ AGGCTTTCATAGTTTTTGTATTGTTTCAACCTCGTTTCACGGTAATTCTCT
JMSF036M03+ GAGCGCGAGAGGCTTTCATAGTTTTTGTATTGTTTCAACCTCGTTTCACGGTAATTCTCT
                      ____________________________________________________________
consensus GAGCGCGAGAGGCTTTCATAGTTTTTGTATTGTTTCAACCTCGTTTCACGGTAATTCTCT
 
. : . : . : . : . : . :
JMSF029F20+ CTGGTAAAATTGAAACGTTCCCACGGAATACCTTGGATATCCTTGCCATGTCTGGCTTCA
JMFF045N18+ CTGGTAAAATTGAAACGTTCCCACGGAATACCTTGGATATCCTTGCCATGTCTGGCTTCA
JMFS104C01+ CTGGTAAAATTGAAACGTTCCCACGGAATACCTTGGATATCCTTGCCATGTCTGGCTTCA
JMSF036M03+ CTGGTAAAATTGAAACGTTCCCACGGAATACCTTGGATATCCTTGCCATGTCTGGCTTCA
                      ____________________________________________________________
consensus CTGGTAAAATTGAAACGTTCCCACGGAATACCTTGGATATCCTTGCCATGTCTGGCTTCA
 
. : . : . : . : . : . :
JMSF029F20+ AGAGCTGATGTATCGGTCACCGGATTACTCGTTTCAAAATCATCCTCAAAGTCAGAATCT
JMFF045N18+ AGAGCTGATGTATCGGTCACCGGATTACTCGTTTCAAAATCATCCTCAAAGTCAGAATCT
JMFS104C01+ AGAGCTGATGTATCGGTCACCGGATTACTCGTTTCAAAATCATCCTCAAAGTCAGAATCT
JMSF036M03+ AGAGCTGATGTATCGGTCACCGGATTACTCGTTTCAAAATCATCCTCAAAGTCAGAATCT
                      ____________________________________________________________
consensus AGAGCTGATGTATCGGTCACCGGATTACTCGTTTCAAAATCATCCTCAAAGTCAGAATCT
 
. : . : . : . : . : . :
JMSF029F20+ CCAGAGTCCTCAACAACAGGCCACCGAGATTCGACCGTGCTGCCTTGAAATGGACTGTCA
JMFF045N18+ CCAGAGTCCTCAACAACAGGCCACCGAGATTCGACCGTGCTGCCTTGAAATGGACTGTCA
JMFS104C01+ CCAGAGTCCTCAACAACAGGCCACCGAGATTCGACCGTGCTGCCTTGAAATGGACTGTCA
JMSF036M03+ CCAGAGTCCTCAACAACAGGCCACCGAGATTCGACCGTGCTGCCTTGAAATGGACTGTCA
                      ____________________________________________________________
consensus CCAGAGTCCTCAACAACAGGCCACCGAGATTCGACCGTGCTGCCTTGAAATGGACTGTCA
 
. : . : . : . : . : . :
JMSF029F20+ TCAAAACCAGACACGTTATGGTAGTGATCAACCATGGACTCGTGCTCGCGGCTCCTATGA
JMFF045N18+ TCAAAACCAGACACGTTATGGTAGTGATCAACCATGGACTCGTGCTCGCGGCTCCTATGA
JMFS104C01+ TCAAAACCAGACACGTTATGGTAGTGATCAACCATGGACTCGTGCTCGCGGCTCCTATGA
JMSF036M03+ TCAAAACCAGACACGTTATGGTAGTGATCAACCATGGACTCGTGCTCGCGGCTCCTATGA
JMSF004G20+ ACCAGACACGTTATGGTAGTGATCAACCATGGACTCGTGCTCGCGGCTCCTATGA
                      ____________________________________________________________
consensus TCAAAACCAGACACGTTATGGTAGTGATCAACCATGGACTCGTGCTCGCGGCTCCTATGA
 
. : . : . : . : . : . :
JMSF029F20+ GTTTGCGCCATTGTCCAGAAATAACACTTGAAAAAACCGAAGCGAGCTAACGAAAGCTTT
JMFF045N18+ GTTTGCGCCATTGTCCAGAAATAACACTTGAAAAAACCGAAGCGAGCTAACGAAAGCTTT
JMFS104C01+ GTTTGCGCCATTGTCCAGAAATAACACTTGAAAAAACCGAAGCGAGCTAACGAAAGCTTT
JMSF036M03+ GTTTGCGCCATTGTCCAGAAATAACACTTGAAAAAACCGAAGCGAGCTAACGAAAGCTTT
JMSF004G20+ GTTTGCGCCATTGTCCAGAAATAACACTTGAAAAAACCGAAGCGAGCTAACGAAAGCTTT
                      ____________________________________________________________
consensus GTTTGCGCCATTGTCCAGAAATAACACTTGAAAAAACCGAAGCGAGCTAACGAAAGCTTT
 
. : . : . : . : . : . :
JMSF029F20+ GAAGTTACGGAGAATTGAGGCTTTGAAACTAAGTAACTAACGCCGACGAAAGAGAGACAG
JMFF045N18+ GAAGTTACGGAGAATTGAGGCTTTGAAACTAAGTAACTAACGCCGACGAAAGAGAGACAG
JMFS104C01+ GAAGTTACGGAGAATTGAGGCTTTGAAACTAAGTAACTAACGCCGACGAAAGAGAGACAG
JMSF036M03+ GAAGTTACGGAGAATTGAGGCTTTGAAACTAAGTAACTAACGCCGACGAAAGAGAGACAG
JMSF004G20+ GAAGTTACGGAGAATTGAGGCTTTGAAACTAAGTAACTAACGCCGACGAAAGAGAGACAG
                      ____________________________________________________________
consensus GAAGTTACGGAGAATTGAGGCTTTGAAACTAAGTAACTAACGCCGACGAAAGAGAGACAG
 
. : . : . : . : . : . :
JMSF029F20+ AGTATGTTCGCAGGGACGGTTCAAAGAATTCCCGATCGGAAAACAACGCCGACTCCTTGG
JMFF045N18+ AGTATGTTCGCAGGGACGGTTCAAAGAATTCCCGATCGGAAAACAACGCCGACTCCTTGG
JMFS104C01+ AGTATGTTCGCAGGGACGGTTCAAAGAATTCCCGATCGGAAAACAACGCCGACTCCTTGG
JMSF036M03+ AGTATGTTCGCAGGGACGGTTCAAAGAATTCCCGATCGGAAAACAACGCCGACTCCTTGG
JMSF004G20+ AGTATGTTCGCAGGGACGGTTCAAAGAATTCCCGATCGGAAAACAACGCCGACTCCTTGG
                      ____________________________________________________________
consensus AGTATGTTCGCAGGGACGGTTCAAAGAATTCCCGATCGGAAAACAACGCCGACTCCTTGG
 
. : . : . : . : . : . :
JMSF029F20+ GAAATCGATCGCCGGAATCGAAGATTTGTACTACGAAGACGGATGCCAGTAGCAAACGGA
JMFF045N18+ GAAATCGATCGCCGGAATCGAAGATTTGTACTACGAAGACGGATGCCAGTAGCAAACGGA
JMFS104C01+ GAAATCGATCGCCGGAATCGAAGATTTGTACTACGAAGACGGATGCCAGTAGCAAACGGA
JMSF036M03+ GAAATCGATCGCCGGAATCGAAGATTTGTACTACGAAGACGGATGCCAGTAGCAAACGGA
JMSF004G20+ GAAATCGATCGCCGGAATCGAAGATTTGTACTACGAAGACGGATGCCAGTAGCAAACGGA
                      ____________________________________________________________
consensus GAAATCGATCGCCGGAATCGAAGATTTGTACTACGAAGACGGATGCCAGTAGCAAACGGA
 
. : . : . : . : . : . :
JMSF029F20+ GAGCTCCAG
JMFF045N18+ GAGCTCCAGTGCTTGCCGCCGGTGAAGTA
JMFS104C01+ GAGCTCCAGTGCTTGCCGCCGGTGAAGTACAGAACGTAA
JMSF036M03+ GAGCTCCAGTGCTTGCCGCCGGTGAAGTACAGAACGTAATTATAGCGGTAAATCCTTGCC
JMSF004G20+ GAGCTCCAGTGCTTGCCGCCGGTGAAGTACAGAACGTAATTATAGCGGTAAATCCTTGCC
                      ____________________________________________________________
consensus GAGCTCCAGTGCTTGCCGCCGGTGAAGTACAGAACGTAATTATAGCGGTAAATCCTTGCC