Previous Contig 004607:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS065G12Sequence620004607 (2)gb:AF334208_17874421e-20Arabidopsis thaliana bZIP protein DPBF3 mRNA, complete cds.
JMSF004G09Sequence406004607 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS065G12+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFS065G12+ CGCCCAGGGTAGCTTTCCTCTCGAGATTGCTACTCTTCTGCCCCTGCTGGATATCCTGCC
                      ____________________________________________________________
consensus CGCCCAGGGTAGCTTTCCTCTCGAGATTGCTACTCTTCTGCCCCTGCTGGATATCCTGCC
 
. : . : . : . : . : . :
JMFS065G12+ ACACCTCATCAACTGTCTTCTTGCTCAGATCACCAGACAGCTCGAGGCTGGACTGGTGAT
                      ____________________________________________________________
consensus ACACCTCATCAACTGTCTTCTTGCTCAGATCACCAGACAGCTCGAGGCTGGACTGGTGAT
 
. : . : . : . : . : . :
JMFS065G12+ GAAGCGAGGCCCCCGAAGGCAGTGGGGTGCCACTGTAATCAACCCGCTGCACCCCTTGGC
                      ____________________________________________________________
consensus GAAGCGAGGCCCCCGAAGGCAGTGGGGTGCCACTGTAATCAACCCGCTGCACCCCTTGGC
 
. : . : . : . : . : . :
JMFS065G12+ TCGCCTCGGCTGTGCACACAGTCTTCAGAAGCTCATCCAGATTCATACTGCTCAAGGGTT
                      ____________________________________________________________
consensus TCGCCTCGGCTGTGCACACAGTCTTCAGAAGCTCATCCAGATTCATACTGCTCAAGGGTT
 
. : . : . : . : . : . :
JMFS065G12+ TCCCTAAACCCCCAAATTGCTGATGAACCTCATCAAGAGTGAGACTATACAGAGACCCTT
                      ____________________________________________________________
consensus TCCCTAAACCCCCAAATTGCTGATGAACCTCATCAAGAGTGAGACTATACAGAGACCCTT
 
. : . : . : . : . : . :
JMFS065G12+ CCCTTTCCAATCCATTTGATTTCGGGTCTTGCATTAGGGTTCCACCACAACCCCCCTCAG
                      ____________________________________________________________
consensus CCCTTTCCAATCCATTTGATTTCGGGTCTTGCATTAGGGTTCCACCACAACCCCCCTCAG
 
. : . : . : . : . : . :
JMFS065G12+ ATCCCATAAACTTCTAACCCTACCAACAACCTAGATCGATTCCACTCCCTCCAATACACA
                      ____________________________________________________________
consensus ATCCCATAAACTTCTAACCCTACCAACAACCTAGATCGATTCCACTCCCTCCAATACACA
 
. : . : . : . : . : . :
JMFS065G12+ ATCAATCAATCAATCCCCTCTCCCAGAACCCCCTTTAATCATTCCATGCATAAATTATAA
                      ____________________________________________________________
consensus ATCAATCAATCAATCCCCTCTCCCAGAACCCCCTTTAATCATTCCATGCATAAATTATAA
 
. : . : . : . : . : . :
JMFS065G12+ ACCACAACGATTCGCATCAAACAACAAGCTCGCTAGCTAGCAGAAGCACAAAAGAAGAGT
JMSF004G09+ AGCTAGCAGAAGCACAAAAGAAGAGT
                      ____________________________________________________________
consensus ACCACAACGATTCGCATCAAACAACAAGCTCGCTAGCTAGCAGAAGCACAAAAGAAGAGT
 
. : . : . : . : . : . :
JMFS065G12+ CCCGTCTCAAAAAGACTGGATTCTTGTGCAGCTCCAGCGTTCCCTCCCAAGAGAACAAGA
JMSF004G09+ CCCGTCTCAAAAAGACTGGATTCTTGTGCAGCTCCAGCGTTCCCTCCCAAGAGAACAAGA
                      ____________________________________________________________
consensus CCCGTCTCAAAAAGACTGGATTCTTGTGCAGCTCCAGCGTTCCCTCCCAAGAGAACAAGA
 
. : . : . : . : . : . :
JMFS065G12+ AAACCCAAACACCATTTCC
JMSF004G09+ AAACCCAAACACCATTTCCCCTTGCTGTGTTAAACCTGAGTGCTGACTGGCTGTCTCTAA
                      ____________________________________________________________
consensus AAACCCAAACACCATTTCCCCTTGCTGTGTTAAACCTGAGTGCTGACTGGCTGTCTCTAA
 
. : . : . : . : . : . :
JMSF004G09+ GTCATGGAAATTGCAGAAAGTCAGAAACTCCACTCCATCAAGTACAATTTTGTAGCACTC
                      ____________________________________________________________
consensus GTCATGGAAATTGCAGAAAGTCAGAAACTCCACTCCATCAAGTACAATTTTGTAGCACTC